Primer combination for genetic integrity analysis of common wild rice and application of primer combination
A primer combination, wild rice technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc., can solve problems such as distribution area degradation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] The genetic integrity analysis of embodiment 1 common wild rice germplasm
[0059] 1. Experimental materials
[0060] The common wild rice in Dongxiang, Jiangxi Province was used as the test material, and a certain amount of seeds were transplanted to the field for routine management. Randomly select 160 individual plants, take their young leaves, and freeze them at -20°C for later use.
[0061] 2. Genomic DNA extraction: Genomic DNA of 160 individual leaves were extracted by CTAB method.
[0062] 3. Primer synthesis and screening
[0063] (1) Synthetic primers: With reference to the rice SSR primer sequence, 550 pairs of primers were randomly selected, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0064] (2) Primer screening: using 160 single-plant DNA templates, using all 550 pairs of primers to amplify, the amplified products were subjected to polyacrylamide gel electrophoresis and gel silver staining, and the non-polymorphic one...
Embodiment 2
[0068] Example 2 Analysis of Genetic Integrity of Common Wild Oryza Germplasm in Different Vitality Populations
[0069] 1. Experimental materials
[0070] The common wild rice in Dongxiang, Jiangxi was used as the test material. Common wild rice seeds were collected, and high-temperature and high-humidity methods were used to age the seeds to obtain populations with different germination rates (see Table 2 for details). Each population took a certain amount of seeds to grow seedlings and transplanted them to the field for routine management. 160 individual plants were randomly selected from each group, and the young leaves were taken and frozen at -20°C for future use.
[0071] 2. Genomic DNA extraction: Genomic DNA of 160 individual leaves were extracted by CTAB method.
[0072] 3. Comparison of genetic integrity of different vitality populations: Using the above 25 pairs of core primers, the genomic DNA of 5 different vitality populations of common wild rice was amplified...
Embodiment 3
[0077] Example 3 is used for the primer combination of common wild rice genetic integrity analysis
[0078] SSR01 forward primer SEQ ID NO.1caatttccataggctgcatg
[0079] Reverse primer SEQ ID NO.2gcttgggttagcgacgac
[0080] SSR02 forward primer SEQ ID NO.3tctttggaggcgagctgag
[0081] Reverse primer SEQ ID NO.4cgaagggtacatctgcttag
[0082] SSR03 forward primer SEQ ID NO.5gtacggaaaacatggtaggaag
[0083] Reverse primer SEQ ID NO.6tcgagggaaggatctggtc
[0084] SSR04 Forward Primer SEQ ID NO.7ggagcgggagagagagcccacg
[0085] Reverse primer SEQ ID NO.8 tgccgatgaaggactgcgacgc
[0086] SSR05 Forward Primer SEQ ID NO.9ctgatcgagagcgttaaggg
[0087] Reverse primer SEQ ID NO.10gggatcaaaccacgtttctg
[0088] SSR06 Forward Primer SEQ ID NO.11ctactcctctgtccctcctctc
[0089] Reverse primer SEQ ID NO.12 ccagctagacacaatcgagc
[0090] SSR07 forward primer SEQ ID NO.13agcgacgccaagacaagtcggg
[0091] Reverse primer SEQ ID NO.14tccacgtcgatcgacacgacgg
[0092] SSR08 Forward Primer SEQ ID NO....
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap