DNA bar code standard gene used for identifying culex tritaeniorhynchus and applications
A standard gene and barcode technology, used in recombinant DNA technology, DNA/RNA fragments, and microbial determination/inspection, etc., can solve the problems of prolonged customs clearance period, incomplete samples, and low accuracy of morphological classification methods, and achieves the promotion of The effect of improved quality, improved accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0031] A DNA barcode standard gene for identifying Culex tritaeniorhynchus, the nucleotide sequence (679bp) of the gene is as follows:
[0032] TTTTATTTTTGGAGCTTGAGCTGGAATAGTTGGTACTTCTTTAAGTATTTTAATTCGAGCAGAATTAAGTCAACCTGGAGTATTTATTGGAAATGATCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCTCCTGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTAACTCTACTACTTTCAAGTAGTTTAGTAGAAAATGGGGCTGGAACTGGATGAACAGTTTATCCACCTCTATCATCTGGAACAGCACACGCTGGAGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGGATTTCATCAATTTTAGGGGCAGTAAATTTTATTACAACAGTAATTAATATACGATCTTCAGGAATTACACTTGATCGAATGCCTTTATTTGTTTGATCAGTAGTAATTACTGCTGTTTTATTACTTCTTTCACTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAATTGGAGGAGGAGACCCAATTCTTTATCAACACTTAGTCTGATTTTTTGGTCACCGGGGAAGTAAAAAA。
[0033] The molecular biological identification method for identifying Culex tritaeniorhynchus using the DNA barcode standard gene for identifying Culex tritaeniorhync...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com