Specific rice high-resistance bacterial leaf blight gene marker and application thereof
A bacterial blight and specific technology, which is applied in the field of molecular genetic breeding, can solve the problems of hybrid rice resistance and durability can not be guaranteed, and achieve the effect of improving breeding efficiency, good stability, and short cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Primer synthesis: Entrust Life Technologies to synthesize Xa7GSM-labeled primers. The primer sequence is:
[0030] 5'CCTGCTCGAGCTAATCCAATC 3' and 5'GATACTGTCATTCTTCACGGTCTG 3'.
[0031] 2. DNA extraction: use rice leaves as materials to extract genomic DNA. There are many DNA extraction methods reported, and one can be selected arbitrarily. This case uses the report by Panaud et al. (Mol Gen Genet, 1996, 252:597-607) Methods.
[0032] 3. PCR amplification: In a 0.2ml thin-walled tube dedicated to PCR amplification, add 20ng of rice DNA, 0.25μM each of the two primers, 2×Taq PCR Master Mix (TIANGEN company), use ddH 2 O dilute to 20μl, mix thoroughly. PCR amplification was carried out on a thermal cycler, and the amplification conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, 35 cycles; extension at 72°C for 5 minutes. The thermal cycler used in the prese...
Embodiment 2
[0042] It is known that the male restorer line "Miryang 46", which is the main hybrid rice planted in Zhejiang Province, does not contain the Xa7 gene ( image 3 ), less resistant to bacterial blight ( Figure 4 ). In order to improve the disease resistance of this rice variety, the inventors crossed IRBB7 with "Miryang 46", and obtained F 1 Dai then conducted multiple backcrosses with “Miryang 46”. However, after each backcross, only a part of the individual plants carry the Xa7 gene, and the individual plants containing the Xa7 gene must be selected for further backcrossing, so as to ensure that the Xa7 gene will not be lost in the long-term breeding. Therefore, each generation of plants was detected by using the marker Xa7GSM of the present invention, and a single plant amplified with a 315bp band, that is, a plant containing the Xa7 gene, was selected for the next round of backcrossing, and the Xa7 gene was successfully transferred In the rice "Miryang 46" ( image 3 )...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com