Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for silencing IFNARI gene in DF-1 cell line

A DF-1 and cell line technology, applied in DNA/RNA fragments, recombinant DNA technology, genetic engineering, etc., can solve the problems of insufficient amount of vaccine antigen and high production cost, and solve the problem of insufficient amount of antigen and high production cost , the effect of reducing production costs

Active Publication Date: 2015-06-10
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the deficiencies existing in the production of existing avian influenza vaccines, to provide a method for silencing the IFNAR1 gene in the DF-1 cell line, which can increase the antigen content of the avian influenza virus in the DF-1 cell line to 5- 10 times, not only can solve the problem of insufficient vaccine antigen and high production cost, but also promote the research and development of bird flu bioreactor cell culture technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for silencing IFNARI gene in DF-1 cell line
  • Method for silencing IFNARI gene in DF-1 cell line
  • Method for silencing IFNARI gene in DF-1 cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] 1. Screening of siRNA that interferes with IFNAR1 gene transcription

[0033] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with IFNAR1 gene

[0034] According to the IFNAR1 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5'-AAATGTGGCTAATTTCTGTGT-3' (SEQ No.1); sh2: 5'-TA CGACGATAATACCTCCAA-3' (SEQ No.2); sh3: 5' -TAGGATCACAGAAGAAGTAAA-3' (SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG (SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and antisense strand, and introduce linker sequences at both ends, and form shRNA by anneali...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for silencing an IFNARI gene in a DF-1 cell line. The method includes the steps that according to the IFNARI gene, multiple pieces of siRNA of an RNA interference target spot sequence are designed, and the siRNA knocking down IFNARI gene expression at the mRNA level is screened out; a lentiviral vector containing an IFNARI RNAi gene is built; by means of the lentiviral vector, the IFNARI RNAi gene is mediated into the DF-1 cell line to silence IFNARI gene expression, and the proliferation titer of an avian influenza virus in the DF-1 cell line is improved. The method can increase the antigen amount of the avian influenza virus in the DF-1 cell line by 5-10 times, the production cost of a vaccine is greatly reduced, the problems that the vaccine is insufficient in antigen amount and high in production cost can be solved, and the research and development process of an avian influenza bioreactor cell culture technology is promoted.

Description

technical field [0001] The invention relates to a method for silencing an interferon receptor 1 (Interferon receptor 1, IFNAR1) gene in a DF-1 cell line, which is used for increasing the proliferation titer of avian influenza virus in the cell line, and belongs to the field of biotechnology. Background technique [0002] With the rapid development of intensive breeding industry, important poultry diseases such as avian influenza are becoming the focus of public health security, and controlling diseases from the source is the top priority of the current prevention and control strategy. Practice has proved that vaccine immunization and rapid detection are the most effective measures to prevent and control major animal diseases. Due to the low titer of avian influenza virus cell culture, poultry embryos are still mainly used to produce vaccines in China at present, which has low efficiency, high energy consumption, and the possibility of foreign virus contamination. my country...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/113C12N15/12
Inventor 李玉峰亓丽红马秀丽刘存霞刘爱玲黄兵刘华雷宋敏训朱建华王绛辉
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com