Primer and kit for detecting vesicular stomatitis viruses and preparation method of kit
A technology for vesicular stomatitis and detection kits, which can be applied in biological testing, measuring devices, material inspection products, etc., and can solve problems such as large risk factors.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The present invention will be explained in detail below in conjunction with the examples.
[0019] 1. Preparation of Sequences
[0020] According to the requirements of GeXP primer design and the genome of VSV published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biological nucleotide sequences, and synthesize Universal primer sequence, and a Cy5 fluorescent tag is added to the 5' end of the upstream universal primer. The obtained primer sequences are: SEQ ID No.1: AGGTGACACTATAGAATATGATACAGTACAATTATTTTGGGA, which is named VSV-F in the present invention; SEQ ID No.2: GTACGACTCACTATAGGGAGAGACTTTCTGTT AGGGATCTGG, which is named VSV-R in the present invention. Universal primers used in the present invention: SEQ ID No. 3: Cy5 AGGTGACACTATAGATA, named UWD-F in the present invention; and SEQ ID No. 4: GTACGACTCACTATAGGGA, named UEV-R in the...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap