Kit for detecting foot-and-mouth disease type-A virus as well as preparation and using methods of kit
A kit and foot-and-mouth disease technology, applied in the field of kits for detecting foot-and-mouth disease type A virus, can solve problems such as inability to distinguish serotypes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The present invention is explained in detail below in conjunction with embodiment.
[0020] 1. Preparation of Sequences
[0021] According to the GeXP primer design requirements and the FMDV-A genome published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biologically derived nucleotide sequences , in addition to synthesizing the universal primer sequence, and adding a Cy5 fluorescent label to the 5' end of the upstream universal primer. The primers of the present invention that can specifically amplify foot-and-mouth disease type A virus nucleic acid: AGGTGACACTATAGAATAGGGTGATCTAGGGTCTCTCGC, named FMDV-A-F in the present invention; GTACGACTCACTATAGGGACAGGAGCTGCTTTGCAGGTGCAAT, named FMDV-A-R in the present invention. Universal primers used in the present invention: Cy5 AGGTGACACTATAGAATA, named UWD-F in the present invention; GTACGACTCAC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com