Mutant type TNF-alpha gene and method of increasing the expression quantity of the antigen TNF-alpha gene

A technology of α gene and mutant type, which is applied in the field of mutant TNF-α gene and increasing the expression of antigen TNF-α gene, which can solve the problems of low efficiency and high cost

Active Publication Date: 2014-07-02
SHENZHEN INST OF ADVANCED TECH
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current commercialized protein TNF-α is very expensive, the price exceeds 70 yuan/μg, and the efficiency of TNF-α production in the laboratory with E. coli express...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant type TNF-alpha gene and method of increasing the expression quantity of the antigen TNF-alpha gene
  • Mutant type TNF-alpha gene and method of increasing the expression quantity of the antigen TNF-alpha gene
  • Mutant type TNF-alpha gene and method of increasing the expression quantity of the antigen TNF-alpha gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The present invention mutates the E. coli rare codons of the third arginine, the 101st proline and the 104th arginine of the human secreted TNFα gene into E. coli preferred codons by means of mutation primers and overlapping PCR. Son, successfully increased the production of TNF-α by 1.57 times, the specific method is as follows:

[0045] (1) Design and synthesis of mutation primers containing NCOI restriction site (underline) and point mutation (italic base) for amplifying mutant TNF-α gene

[0046] F1: CATG CCATGG TC TCATCTTCTCGAACC (SEQ ID NO. 1);

[0047] R1: GCTCTTGATGGCAGAGAGGAG (SEQ ID NO.2) (double underlines are overlapping parts);

[0048] F2: GAGACCCCAGAGGGGGC (SEQ ID NO. 3);

[0049] Downstream primers containing HindIII restriction sites (underlined)

[0050] R2: GCT AAGCTT CAGGGCAATGATCCC (SEQ ID NO. 4).

[0051] Design and synthesis of primers for amplifying wild-type TNF-α gene

[0052] F3: CATG CCATGG TCAGATCATCTTCTCGAACC (SEQ ID NO. 5);...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a mutant type TNF-alpha gene the base composition of which is shown as the SEQ ID NO 7, and discloses a method of increasing the expression quantity of the antigen TNF-alpha gene. The method includes steps of: amplifying by adopting a human secreting type TNF-alpha gene cDNA clone as a template and by adopting the SEQ ID NO 1 and the SEQ ID NO 2 as primers, so as to obtain an amplification product T1; amplifying by adopting the SEQ ID NO 3 and the SEQ ID NO 4 as primers, so as to obtain an amplification product T2; performing overlapping PCR amplification by adopting the amplification product T1 and the amplification product T2 as templates and adopting the SEQ ID NO 1 and the SEQ ID NO 4 as primers, so as to obtain the mutant type TNF-alpha gene; subjecting the mutant type TNF-alpha gene to double digestion; inserting into a pET28a expression vector; converting escherichia coli; and performing induced culture to obtain TNF-alpha protein. Two pairs of escherichia coli rare codons close with each other in the TNF-alpha gene mutant into escherichia coli optimal codons. The expression quantity of the TNF-alpha gene after the codon optimization is increased by at least 1.5 times.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a mutant TNF-α gene and a method for increasing the expression level of the antigen TNF-α gene. Background technique [0002] Tumor necrosis factor α (Tumor necrosis factor α, TNF-α) is a class of cytokines with a wide range of biological activities, mainly produced by monocytes, macrophages, adipocytes, B cells, T cells and natural killer (NK) Cells and other immune cells are produced. TNF-α proteins in vivo include transmembrane TNF-α and secreted TNF-α. Transmembrane TNF-α has a full length of 233 amino acids, of which amino acids 1-76 are signal peptides (including transmembrane amino acids), and amino acids 77-233 are extracellular segments. The 77th-233rd amino acid sequence is also the amino acid sequence of secreted TNF-α, which has a size of 17KD and binds to the TNF receptor (TNFR) on the cell surface in the form of a trimer to mediate various biological effec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/70C12N15/21C12N15/10C12N15/67C07K14/56
Inventor 万晓春李俊鑫任晓虎王蒲
Owner SHENZHEN INST OF ADVANCED TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap