Method for culturing male sterile plant through virus-induced gene silencing system

A technology for male sterility and planting, applied in botany equipment and methods, genetic engineering, plant genetic improvement, etc., can solve problems such as restrictions, hybrid sterile plants, and increased production costs, and achieve short time and low field workload Less, cost-saving effect

Inactive Publication Date: 2014-05-28
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage of this system is that there are 50% fertile plants in the sterile line, and 50% of the fertile plants in the sterile line must be manually removed during parental reproduction and hybrid production, resulting in increased production costs, and once the infertile lines are removed In time, a proportion of sterile lines will appear in the hybrids
However, the use of VIGS technology to silence plant endogenous genes has always had a problem of silencing efficiency, and the proportion of obtained phenotypic materials is less than 30%, which limits the application of this technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for culturing male sterile plant through virus-induced gene silencing system
  • Method for culturing male sterile plant through virus-induced gene silencing system
  • Method for culturing male sterile plant through virus-induced gene silencing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Construction of VIGS vector for silencing rapeseed COI1 gene

[0040] 1.1 Acquisition of rapeseed COI1 gene cDNA

[0041] Cultivate rapeseed seedlings, and when they grow to about 10cm, use TRIZOL method to extract the total RNA of stems and cotyledons, obtain the cDNA corresponding to the total RNA of rapeseed by reverse transcription, take a small amount of cDNA as a template, and the forward primer is: AAATCTAGAGTGTCTCCGAACCATAGGC, reverse The primer is: TTCTCTCACCTCCCAAGCTG, and a 514bp cDNA fragment of rapeseed COI1 gene (SEQ ID NO.1 (1181) to (1694)) is obtained by PCR amplification.

[0042] 1.2 Acquisition of pTRV2 vector containing rapeseed COI1 gene

[0043] Digest the cDNA fragment of the COI1 gene with XbaI, and double-digest the plasmid pTRV2 with XbaI and EcoICRI. The restriction systems are: 1.5 μL Buffer (Buffer3), 1 μL XbaI, 5 μL COII gene cDNA fragment, add water to make up to 15 μL; 1.5 μL Buffer (Buffer MultiCore), 0.5 μL Xba1, 0.5 μL EcoICRI, 0...

Embodiment 2

[0074] 1. Sowing, vernalization and seedling cultivation of experimental rapeseed seedlings

[0075] Sowing rapeseed Zhongshuang No. 11, using plastic fiber as a fixer, MS liquid medium as a nutrient, and spraying 1 / 500 dilution of chlormequat when the stem grows to about 5cm to inhibit excessive growth of rape seedlings. Vernalization begins after half a month , The vernalization conditions are 9 hours during the day, 9°C; 15 hours at night, 40°C. After 14 days of vernalization, it was revived at 12°C for 2 days, 9 hours in the daytime, and 15 hours in the night. After recovery, they were transferred to a 25°C greenhouse for cultivation.

[0076] 2. Infect rapeseed seedlings with Agrobacterium containing VIGS vector, and cultivate rapeseed lines that silence the COI1 gene

[0077] 2.1 Agrobacterium preparation for infection

[0078] GV-C, GV-1 and GV-COI1 were added to 6ml YEB medium, 6μL Rif and 6μL Kan were added, and three single bacteria were inoculated, and the bacter...

Embodiment 3

[0103] The corresponding sequence of tobacco COI1 gene ((444)..(952) of SEQ ID NO.2) was constructed into VIGS vector, and male sterile plants of tobacco were also obtained after infecting tobacco. Such as Figure 8 As shown, silencing of the COI1 gene in tobacco resulted in sterility due to abnormal development of stamens.

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of a virus-induced gene silencing (VIGS) carrier system in culturing a dicot male sterile plant. A VIGS-technology-based efficient practical plant sterile strain creation technical system is created, the sterile rate is more than 96% and can be up to 98%, the system has the characteristic of unstable inheritance, the infertility is not inherited in the later generations, and the gene contamination or the problem about biosafety caused by uncontrollable biotechnology diffusion is avoided. Besides, the method is simple to operate, the consumed time is short, the workload in the field is low, the cost is greatly saved, and the breeding efficiency is improved.

Description

technical field [0001] The invention relates to a carrier system and method for cultivating male sterile plants by means of biotechnology, especially to dicotyledonous plants. Background technique [0002] It is the key to realize the goal of plant cross-breeding to cultivate male sterile lines with stable sterility, thoroughness and good properties in all aspects. At present, the main ways to cultivate male sterile lines in production include cytoplasmic sterile system, nuclear sterile system and chemical male sterile system. [0003] Cytoplasmic male sterility is one of the most widely used and effective methods in the utilization of heterosis in rapeseed, but the sterility of the system male sterile line is not thorough enough and is easily affected by the ambient temperature. Micro pollen is easy to appear under low temperature conditions at the early flowering stage, and the production of micro pollen will force the female parent to self-fertilize, which will reduce th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/83A01H5/00
Inventor 张洪博王文静李加纳杨小川马浩然
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap