Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Real-time fluorescence PCR (polymerase chain reaction) method and primer pair for identifying gender of oreochromis niloticus

A technology of Gifu tilapia and gender, applied in the field of molecular biology, can solve problems such as difficult to distinguish male and female fish, affect continuity, time-consuming and labor-intensive, and achieve high reliability and strong specificity

Inactive Publication Date: 2015-04-22
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the study of spatiotemporal expression, the fish species stage is a critical period, when the sexes have been differentiated, but it is difficult to distinguish male and female fish only by naked eye observation
Male and female fish can be distinguished by lactic acid lichenin red tablet method, but this method is time-consuming and laborious, and also affects the continuity of subsequent experiments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescence PCR (polymerase chain reaction) method and primer pair for identifying gender of oreochromis niloticus
  • Real-time fluorescence PCR (polymerase chain reaction) method and primer pair for identifying gender of oreochromis niloticus
  • Real-time fluorescence PCR (polymerase chain reaction) method and primer pair for identifying gender of oreochromis niloticus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] Part I: Sequencing of the AMH gene of Gifu tilapia

[0018] Genomic DNA extraction from blood of Gifu tilapia, design of primers, PCR amplification, product purification, transfer into vector, blue-white screening, plasmid sequencing, the designed primer sequence is:

[0019] Forward: GCTGTGTGCATTTCAGGAGACA

[0020] Reverse: TGTCTCCTGAAATGCACACAGC

[0021] The intron-containing partial sequence of the obtained Gifu tilapia AMH gene cloned by this method is (SEQ ID NO.5):

[0022] GCTGTGTGCATTTCAGGAGACACACAGTACGTACTCCTGACAGGAAAATCATCAGAGGGGAGTGTTAACGACAGGTGGCATATTACGGCACACAGACAAACTGCCTCATATGA gtgagatatcatcttcttcattttatttccccatctctggttcattgtgtacccctacttacatttcctctcattgtag AGCAAAAACCTAAAAAGCATCTTGATTGGTGAAAAATCAGGAAGTAACATCAGCACGAGTCCACTTCTACTTTTTCTCCGGG GGAACGGGAACTGATACGAG gtcagcccggctttctttctgctgacattcactgtcgtcagagacgcgctcagctttggtttttatttttgctttcccag ATG TGCTTCAGGCTCGCCCCCGGCATCTCTGCAAACTCCTTCCTTTGTGAGATGAATCGCTTGCTGGGTGCTGTGCTCCCTCAGGAACACTTCGCGTCCCTCCCACTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a real-time fluorescence PCR (polymerase chain reaction) method for identifying the gender of oreochromis niloticus, and belongs to the technical field of molecular biology. The research comprises selecting gender-related gene AMH of oreochromis niloticus to design a pair of specific real-time fluorescence PCR primers, wherein the expression quantities of the gene in male fish and female fish have significant difference, the gender of the oreochromis niloticus can be identified by comparing the expression quantity of gene AMH with the expression quantity of adult fish ovary AMH gene. The method provided by the invention is strong in specificity, high in reliability and can be used for identifying the gender of tilapia mossambica at fingerling stage.

Description

technical field [0001] The invention relates to a real-time fluorescent PCR method for determining the sex of gifu tilapia species, and also relates to a primer set used in the method, belonging to the technical field of molecular biology. Background technique [0002] Gifu tilapia belongs to the order Perciformes, the family Carridae, and the genus Tilapia. Because of its miscellaneous feeding habits, low oxygen resistance, fast growth and strong disease resistance, it has become a worldwide farmed fish. During the breeding process, the growth of male and female tilapias is significantly different, and the male fish grows faster than the female fish, which often leads to a large difference in the specifications of the ponds, thereby reducing the quality of commercial fish and reducing economic benefits. Therefore, carrying out research on the sex determination mechanism of Gifu tilapia and exploring the all-male breeding technology of Gifu tilapia have important economic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q2561/113C12Q2545/114
Inventor 唐永凯李建林李红霞俞菊华徐跑
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com