Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vacuole proton pyrophosphatase as well as encoding gene and application thereof

A technology of pyrophosphatase and encoding gene, applied in the fields of molecular biology and biology, can solve problems such as affecting plant growth, crop planting, soil affecting agricultural production and ecological environment, crop yield loss, etc., achieving good application prospects and improving plant resistance. Inverse level effect

Inactive Publication Date: 2014-02-26
HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Drought seriously affects plant growth and crop planting, causing great losses to crop yields
In addition, soil salinization is also a serious problem affecting agricultural production and the ecological environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vacuole proton pyrophosphatase as well as encoding gene and application thereof
  • Vacuole proton pyrophosphatase as well as encoding gene and application thereof
  • Vacuole proton pyrophosphatase as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The acquisition of embodiment 1 tonoplast proton pyrophosphatase (TAVP)

[0032] 1. Using 3'-RACE method to obtain the 3' terminal sequence of tonoplast proton pyrophosphatase (TAVP)

[0033] Primers were designed according to the conserved region of the tonoplast proton pyrophosphatase gene (VP) of barley, corn, and rice: TAVP3RACE-S: 5'GCYGAYCTTGTYGGCAARGTT3' (merger primers, wherein, R and Y are merge base symbols; R represents G or A; Y indicates T or C) and TAVP3RACE-A: 5'GCAGTGGTAACAACGCAGAGT3'.

[0034] The stress-resistant strain of wheat used was Luohan 2 (from the Institute of Drought-Resistant Economic Crops, Hebei Academy of Agricultural Sciences). The seedlings were cultivated to the stage of two leaves and one heart, treated with 20% PEG6000 for 1 hour, and the whole plants were taken, and the total RNA of wheat was extracted by TRIZOL (Saibaisheng Company). Take 1 μg of total RNA, use MMLV (promega company) to prepare cDNA, the whole operation is carrie...

Embodiment 2

[0058] Example 2 Functional verification of the tonoplast proton pyrophosphatase and its coding gene of the present invention

[0059] 1. Construction of expression vector for tonoplast proton pyrophosphatase gene (TAVP)

[0060] The 35S promoter of pCambial380 was amplified by PCR, and the primers used were 5'-CCGAATTCCCCAACATGGTGGAGC-3' and 5'-CG GGATCC GCGAAAGCTCGAGAGAG-3', and the length of the amplified 35S promoter was 0.8kb. The fragment was digested with EcoR I and BamH I and inserted between the restriction sites of EcoR I and BamH I of the pCambial380 vector (purchased from Cambia) to obtain a recombinant vector, which was named pCambial380-35S.

[0061] After TAVP was double-digested with BamH I and Hind III, the TAVP fragment was recovered, and inserted between the BamH I and Hind III restriction sites of the vector pCambial380-35S in a positive direction to obtain a recombinant vector, which was carried out Restriction digestion and sequencing identification, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses vacuole proton pyrophosphatase as well as an encoding gene and application thereof and relates to the technical field of molecular biology and biology. A wheat TAVP gene is cloned, the functional identification is carried out in arabidopsis thaliana, a drought-relief and antisalt gene of the wheat is explored, and a foundation can be set for obtaining a good novel wheat strain. The vacuole proton pyrophosphatase has great significance in knowing the resistance mechanism of a plant, and a theoretical direction can be provided to assemble molecules, improve the crop stress resistance and improve the crop yield in the future.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a vacuolar proton pyrophosphatase, its coding gene and its application. Background technique [0002] Drought is a worldwide problem. One-third of the cultivated land in the world is in arid and semi-arid state, and more than 40 countries are short of water. Drought seriously affects plant growth and crop planting, causing great losses to crop yields. In addition, soil salinization is also a serious problem affecting agricultural production and ecological environment. With the increase of population and the decrease of arable land, how to use large areas of arid land and saline-alkali land to develop agriculture and cultivate crops that are both drought- and salt-resistant has become a major issue that urgently needs to be solved internationally and in bioscience and technology. [0003] h + Transport inorganic pyrophosphatase (H + -pyrophosphatase,H + -P...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/14C12N15/55C12N15/82A01H5/00
CPCC12N9/14C12N15/8273C12Y306/01009
Inventor 朱昀李朝炜刘颖魏景芳李冬杰
Owner HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products