Vacuole proton pyrophosphatase as well as encoding gene and application thereof
A technology of pyrophosphatase and encoding gene, applied in the fields of molecular biology and biology, can solve problems such as affecting plant growth, crop planting, soil affecting agricultural production and ecological environment, crop yield loss, etc., achieving good application prospects and improving plant resistance. Inverse level effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The acquisition of embodiment 1 tonoplast proton pyrophosphatase (TAVP)
[0032] 1. Using 3'-RACE method to obtain the 3' terminal sequence of tonoplast proton pyrophosphatase (TAVP)
[0033] Primers were designed according to the conserved region of the tonoplast proton pyrophosphatase gene (VP) of barley, corn, and rice: TAVP3RACE-S: 5'GCYGAYCTTGTYGGCAARGTT3' (merger primers, wherein, R and Y are merge base symbols; R represents G or A; Y indicates T or C) and TAVP3RACE-A: 5'GCAGTGGTAACAACGCAGAGT3'.
[0034] The stress-resistant strain of wheat used was Luohan 2 (from the Institute of Drought-Resistant Economic Crops, Hebei Academy of Agricultural Sciences). The seedlings were cultivated to the stage of two leaves and one heart, treated with 20% PEG6000 for 1 hour, and the whole plants were taken, and the total RNA of wheat was extracted by TRIZOL (Saibaisheng Company). Take 1 μg of total RNA, use MMLV (promega company) to prepare cDNA, the whole operation is carrie...
Embodiment 2
[0058] Example 2 Functional verification of the tonoplast proton pyrophosphatase and its coding gene of the present invention
[0059] 1. Construction of expression vector for tonoplast proton pyrophosphatase gene (TAVP)
[0060] The 35S promoter of pCambial380 was amplified by PCR, and the primers used were 5'-CCGAATTCCCCAACATGGTGGAGC-3' and 5'-CG GGATCC GCGAAAGCTCGAGAGAG-3', and the length of the amplified 35S promoter was 0.8kb. The fragment was digested with EcoR I and BamH I and inserted between the restriction sites of EcoR I and BamH I of the pCambial380 vector (purchased from Cambia) to obtain a recombinant vector, which was named pCambial380-35S.
[0061] After TAVP was double-digested with BamH I and Hind III, the TAVP fragment was recovered, and inserted between the BamH I and Hind III restriction sites of the vector pCambial380-35S in a positive direction to obtain a recombinant vector, which was carried out Restriction digestion and sequencing identification, the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap