Molecular markers closely linked to major gene loci for moisture resistance traits in sesame and their applications

Abstract

The invention relates to a molecular marker tightly linked with a main effective genetic locus embodying sesame dampness resistance and application thereof. The main effective genetic locus qWHCHL09 is located on the 9th linkage group, and the molecular marker tightly linked with the main effective genetic locus is ZM428 whose sequences are as follows: ZM428F: AGGATGATGATGTGATGAGAG (5'-3') and ZM428R: CTGCTACTCCTTTTGTCTCTG (5'-3'). The molecular marker is obtained by hybridizing sesame 13 in sesame dampness-resistant varieties and a sensitive germplasm Yiyangbai to obtain F6-generation segregation population, namely a recombinant inbred line (RIL) population, and performing molecular genetic linkage analysis on the F6-generation segregation population. The molecular marker tightly linked with the main effective genetic locus embodying the sesame dampness resistance is applied to breeding of the sesame dampness-resistant varieties and screening of dampness-resistant traits of the sesame germplasm as well as early prediction; the auxiliary dampness resistance choosing target is clear; and the cost is relatively low.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a main effect gene locus of moisture resistance traits of sesame, its closely linked molecular markers and applications thereof. Background technique [0002] Sesamum (Sesamum indicum L.) is a traditional characteristic oil crop in my country. It is planted all over the country. It has high economic and nutritional value. It is not only loved by people, but also widely used in food, medicine and other industries. my country is one of the main sesame producing countries in the world, with the yield per unit area ranking first in the world and the total output accounting for one-fifth of the world. In recent years, the domestic demand for sesame has increased year by year, reaching one million tons, and the import volume ranks first in the world, reaching about 400,000 tons for three consecutive years. However, the total supply of domestic...

AI Technical Summary

Problems solved by technology

Since the 1970s, sesame breeders in my country have taken improving the moisture resistance of varieties as one of the main breeding goals. Through identification, it has been found that the moisture resistance of sesame materials with different genetic backgrounds varies greatly, and the resources with strong moisture resistance Using techniques such as hybridization for parents can improve the moisture resistance of varieties to a certain extent, but no breakthrough has been made so far, and it is still a "bottleneck" problem restricting the development of sesame production in my country

The main problems in the research are: 1) Lack of excellent genetic resources for high humidity tolerance, and narrow genetic basis; 2) Conventional field selection methods for moisture tolerance phenotypes are heavy workload and easily affected by the environment, and breeders basically do not use them, which limits moisture tolerance The pace of breeding; 3) There is a lack of effective markers and efficient and accurate selection techniques that can be used for molecular assisted selection of moisture tolerance; 4) The mining of moisture tolerance functional genes is seriously lagging behind, and it is impossible to use advanced genetic engineering breeding to improve the moisture tolerance of sesame

However, there is no research report on the mapping of sesame moisture tolerance genes at home and abroad.

Images