NASBA kit for detecting monkey pox virus and application thereof
A technology of monkeypox virus and kit, which is applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve the effect of simple operation, guaranteed specificity and high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the preparation of the NASBA kit that detects monkeypox virus and the establishment of reaction system
[0047] One, the preparation of the NASBA kit that detects monkeypox virus
[0048] 1. Design of primers and probes
[0049] According to the conserved sequence (48332-48780 of GenBank: AF380138, sequence 4) in the whole monkeypox virus genome (GenBank: AF380138), a set of primers and probes were designed, which were forward primer P1, reverse primer P2 and probe The gene sequences of needles, primers and probes are as follows:
[0050] Primer P1 (sequence 1):
[0051] 5'-AATTCTAATACGACTCACTATAGGGAGAAGGCAGCATCACCTATAGATGAC-3'
[0052] Primer P2 (SEQ ID NO: 2): 5'-TACAGAGCTTTATTAACTTCTCGCTT-3'
[0053] Probe (Sequence 3): 5'- CATCG GAACGACGAACCACCAGAGGATGA CGATG -3'
[0054] Among them, the 32nd-51st position of primer P1 (sequence 1) is a specific sequence complementary to the 3' end of monkeypox virus conservative sequence (396-415th position o...
Embodiment 2
[0078] Embodiment 2, the specific detection of the NASBA kit that detects monkeypox virus
[0079] Samples to be tested: positive control plasmid (pGSI-MPV plasmid), sheeppox vaccine, chickenpox vaccine, vaccinia vaccine, chickenpox vaccine. Wherein, the above-mentioned poxvirus vaccines use DNA extraction kits to extract genomic DNA according to the instructions for future use.
[0080] Using the reaction solution I and the enzyme mixture II in step one and two of embodiment 1, measure according to the operation method described in step two of embodiment 1, and determine the result according to the detection result determination method in step two of embodiment 1 ( I) and (II) judge the results respectively, so as to test the specificity of the NASBA kit. At the same time, the experiment was set up with sterilized double distilled water as the negative control of the sample to be tested.
[0081] The results of agarose gel electrophoresis of RNA amplification products were ...
Embodiment 3
[0082] Embodiment 3, detect the sensitivity detection of the NASBA kit of monkeypox virus
[0083] The positive control plasmid (pGSI-MPV plasmid) was used as the sample to be tested, and the sensitivity of the NASBA kit prepared in Example 1 was tested. At the same time, the experiment was set up with sterilized double distilled water as the negative control of the sample to be tested. The specific operation is as follows:
[0084] Take the positive control plasmid (pGSI-MPV plasmid plasmid) of known concentration, and dilute it by 10 times to the following serial concentrations: 2.76, 2.76×10 1 , 2.76×10 2 , 2.76×10 3 , 2.76×10 4 , 2.76×10 5 , 2.76×10 6 , 2.76×10 7 Copy number / μL. Using the positive control plasmid (pGSI-MPV plasmid) of the obtained serial concentrations as a template, use the reaction solution I and the enzyme mixture II in Step 1 and 2 of Example 1, according to the steps described in Step 2 of Example 1 The operation method is to measure, and the...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com