Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker
A technology of molecular markers and major genes, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA preparation, etc., to achieve the effects of improving selection efficiency and quality, speeding up the selection process, and saving production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] A molecular marker closely linked to the main effect gene locus of spikelet number in wheat,
[0036] labeled primers Xbarc192 ,
[0037] The left end primer sequence GCGAATAGCACTATGGTAAACATTGAGGTAC (as described in SEQ ID NO: 1)
[0038] Right end primer sequence GCGGGTTCAATTATCAAAAGGCACAG (as described in SEQ ID NO: 2)
[0039] and labeled primers Xbarc253 ,
[0040] Left end primer sequence GGGAAGACACGACACGACTC (as described in SEQ ID NO:3)
[0041] Right end primer sequence TCGTAAGATTACCTCGGATGAAGAA (as described in SEQ ID NO:4)
[0042] The DNA of wheat variety Jing 411 was amplified by PCR respectively. The PCR amplification system was 20 μl, including: 1.0 μl each of the left and right primers (10 μmol / L), 10×Buffer 2.0 μl, Mg 2+ (25 mmol / L) 1.2 μl, Taq enzyme (5 U / μl) 0.2 μl, dNTP (2.5 mmol / L) 0.6 μl, DNA (30 ng / μl) 2.0 μl, and ddH for the rest 2 O supplementation; PCR amplification program: pre-denaturation at 94°C for 7 min; denaturation at 94°C for 30...
Embodiment 2
[0056] The main effect gene loci with wheat spikelet number provided by the present invention QTss.cas-7A Application of tightly linked molecular markers in 10 derived lines of wheat variety Jing 411 and wheat variety Xiaoyan 54.
[0057] Using Xiaoyan 54 as the female parent and Jing 411 as the male parent, the F 7 Recombinant inbred line populations (RIL populations). labeled primers Xbarc192 and Xbarc253 Jing 411, Xiaoyan 54 and 10 derivative lines were analyzed. The specific steps are as follows:
[0058] (1) The wheat varieties Jing 411, Xiaoyan 54 and 10 derived lines were planted in the field, and the leaves of the plants of each line were separated and extracted by the SDS method;
[0059] The derivative strain of the wheat variety Jing 411 refers to a strain obtained by using Xiaoyan 54 as the female parent and Jing 411 as the male parent through the single-seed propagation method;
[0060] (2) Using labeled primers Xbarc192 and Xbarc253 The obtained DNA wa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com