Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive detection kit for Hashimoto's thyroiditis genes

A technology for Hashimoto's thyroiditis and a kit, applied in the field of molecular biology, can solve problems such as reduced transcriptional activity

Inactive Publication Date: 2013-10-30
解码(上海)生物医药科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gong Ying and Jiang Ling found by studying the relationship between IL-1α, IL-4, IL-6, TNFα gene polymorphisms and autoimmune thyroid diseases, in the Han population in Shandong, China, patients with Hashimoto’s thyroiditis and normal There are differences in the frequency distribution of IL-4(-590) alleles and genotypes among humans, and the frequency of t alleles in the promoter region of IL-4(-590) in patients with Hashimoto's thyroiditis decreases, which may make IL-4(-590) 4 The overall transcriptional activity is reduced, leading to the onset of Hashimoto's thyroiditis through the immune inflammatory response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kits

[0022] 1. Extract DNA template

[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) CTLA4 (A49G) forward primer: 5'CTGAACACCGCTCCCATAAA3'

[0027] CTLA4 (A49G) reverse primer: 5'GAATACAGAGCCAGCCAAGC3'

[0028] (2) IL-4 (C-509T) forward primer: 5'CCTGCTGGGACCCAAACTA3'

[0029] IL-4 (C-509T) reverse primer: 5'ACAGGTGGCATCTTGGAAAC5'

[0030] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ml; 25mM dNTP mixture 0.2ml, 5U / ul Taq enzyme 0.125ml, DNA template 1ml (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ml, ddH2O 19.175ml;

[0031] The reaction conditions are: 94°C for 4 minutes for denaturation and enzyme activation, 94°C for 30 seconds for d...

Embodiment 2

[0044] Example 2. The service of Hashimoto's thyroiditis gene detection for the crowd

[0045] 1. Sampling and DNA extraction

[0046] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.

[0047] 2. Genotype detection

[0048] Using the kit provided by the present invention, carry out DNA sequencing on the two single nucleotide polymorphism sites of A49G on the CTLA4 gene and C-509T on the IL-4 gene of the subject's genomic DNA, and determine the two SNPs The genotype of the locus.

[0049] 3. Risk assessment and analysis of Hashimoto's thyroiditis high-risk population

[0050] Through the analysis of the SNPs genotype of the subjects, a Hashimoto's thyroiditis risk assessment analysis report is issued. The report details the SNP site genetic detection information of A49G on the CTLA4 gene and C-509T on the IL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive detection kit for detecting Hashimoto's thyroiditis genes. The kit comprises specific primers and DNA (deoxyribonucleic acid) sequencing primers for detecting genotypes of 2 mononucleotide polymorphism sites (A49G on CTLA4 gene and C-509T on IL-4 gene), a PCR (polymerase chain reaction) reaction assembly, a PCR product purification assembly, a DNA sequencing reaction assembly and the like. The kit provided by the invention detects genotypes of 2 mononucleotide polymorphism sites closely related to generation of Hashimoto's thyroiditis to evaluate the attack risk level of Hashimoto's thyroiditis, thereby preventing the generation of Hashimoto's thyroiditis in advance. The sampling method is an oral mucosa cell sampling method which is painless and noninvasive and avoids cross infection. The method has the advantage of accurate and reliable sequencing detection result, does not need to buy expensive imported special instruments, and thus, is easy to popularize.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a gene detection kit for Hashimoto's thyroiditis, which evaluates the risk level of Hashimoto's thyroiditis from the genetic level according to the detection results, and guides Hashimoto's thyroiditis Early prevention and treatment of high-risk groups. Background technique [0002] Hashimoto's thyroiditis (HT) is a clinically common autoimmune thyroiditis, manifested as a chronic inflammatory response with autoantibodies in serum and lymphocyte infiltration in the thyroid, and is a type of helper T lymphocyte (Th1 ) mediated autoimmune diseases. Both HT and Graves' disease (GD) are common autoimmune thyroid diseases (AITD). At present, it is believed that the pathogenesis of AITD is caused by the autoimmune response generated by the interaction of various environmental and genetic factors. [0003] Cytotoxic T lymphocyte asso...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 李为为姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com