Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application

A technology of β-lactamase and nucleic acid aptamer, which is applied in biochemical equipment and methods, DNA preparation, DNA/RNA fragments, etc., can solve the problems of time-consuming, disease delay, etc., and achieve stable physical and chemical properties, simple production process, The effect of shortening the detection time

Inactive Publication Date: 2013-03-13
GUANGDONG MEDICAL UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both phenotypic screening and phenotypic confirmation use traditional drug sensitivity testing methods, which take a long time and easily lead to delays in the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application
  • New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: nucleic acid aptamer

[0042] The nucleotide sequence of the nucleic acid aptamer is:

[0043] GCAATGGTACGGTACTTCCTGTTTTATGTTGTGTGTCTTGTTTTGCTACTTTTCGCCGGCCGTTCAAAAGTGCACGCTACTTTGCTAA (SEQ ID NO: 1).

Embodiment 2

[0044] Example 2 Nucleic acid aptamer screening method

[0045] 1. Main reagents and buffers:

[0046] (1) Main reagents:

[0047] 1. NDM-1 for nucleic acid aptamer screening

[0048]The NDM-1 selected in the present invention has a purity greater than 99%, and was kindly donated by Professor Jean-Denis Docquier of the University of Siena, Italy.

[0049] The SDS-PAGE silver staining results of NDM-1 are shown in Figure 1.

[0050] In Figure 1: the first lane is protein MARKER, the second to fourth lanes are the results of NDM-1 electrophoresis, the second lane is 10ng, the third lane is 20ng, and the fourth lane is 40ng protein; the arrow points to NDM-1 protein electrophoresis Bands.

[0051] The results of electrophoresis showed that no obvious protein jumping was seen in the protein electrophoresis band, indicating that the enzyme had a high purity and could be used for the screening of nucleic acid aptamers.

[0052] 2. Random single-stranded DNA library

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnologies, in particular to a New Delhi metallo-beta-lactamase-1 (NDM-1) aptamer, its screening method and application. The aptamer provided in the invention can combine with NDM-1 by high affinity and high specificity, can be used for NDM-1 bacterium detection, and can greatly shorten the detection time, thus laying a foundation for an aptamer-based clinical rapid diagnosis technology of NDM-1. The aptamer provided in the invention has antibody affinity equivalent to that of traditional antibodies, and the production process is simpler, and the cost is lower, so that the aptamer can substitute traditional antibodies and be used in a rapid diagnosis method of metallo-beta-lactamase.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleic acid aptamer capable of binding to New Delhi metallo-beta-lactamase 1 with high affinity and high specificity, a screening method and application thereof. Background technique [0002] Metallo β-lactamases (MBLs for short) have stable and efficient hydrolysis activity of carbapenems (serine enzymes cannot hydrolyze them), and can catalyze the hydrolysis of almost all β-endo Amide antibiotics, and MBLs cannot be inhibited by clinically available MBLs inhibitors. At present, MBLs have been isolated from a variety of clinical Gram-negative strains. In addition, silenced genes encoding MBLs have also been found in Bacillus anthracis. [0003] In 2010, a new type of bacterial variant gene appeared in South Asian countries such as India and Pakistan. Bacteria with this gene are resistant to most antibiotics including cephalosporins, carbapenems, and aminoglycosides. Scientists ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12N15/10C12Q1/68C12Q1/34
Inventor 赵祖国喻云梅刘仿李国明张腊喜米娜晏双双许壁榆
Owner GUANGDONG MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com