Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant stress tolerance related protein TaMYB19, and coding gene and application thereof

A gene and coding technology, applied to the plant stress tolerance related protein TaMYB19 and its encoded gene and application fields, can solve the problems of complex plant stress resistance mechanism, achieve broad application and market prospects, and improve the effect of stress tolerance

Active Publication Date: 2014-06-04
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The mechanism of plant resistance to stress is very complex. Although traditional breeding methods have some effect on improving the stress resistance of crops, they are still far from the desired goal.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, discovery of TaMYB19 protein and its coding gene

[0042] In order to study the function of wheat MYB gene in plant stress resistance, 60 genes encoding wheat MYB protein were screened from 30,000 non-redundant wheat full-length cDNA sequences sequenced in the laboratory by bioinformatics method. The expression patterns of 60 wheat MYB genes under stress conditions were studied by semi-quantitative PCR, and the genes induced by stress were screened out.

[0043] The protein shown in Sequence 1 of the Sequence Listing is named TaMYB19 protein, which consists of 247 amino acid residues. The gene encoding the TaMYB19 protein is named TaMYB19 gene, and its open reading frame is shown in the sequence 2 of the sequence listing from the 58th to the 798th nucleotide at the 5' end (741bp).

Embodiment 2

[0044] Embodiment 2, the expression pattern of TaMYB19 gene under stress conditions

[0045] Chinese spring wheat at two-leaf-one-heart stage was treated with low temperature stress and abscisic acid stress. Chadian red wheat at the two-leaf and one-heart stage was subjected to salt stress treatment. Hanxuan No. 10 wheat at the stage of two leaves and one heart was subjected to drought stress treatment.

[0046] Salt stress treatment: treatment with 250mM NaCl aqueous solution;

[0047] Drought stress treatment: process with 16.1% PEG aqueous solution;

[0048] Abscisic acid stress treatment: process with 200uM ABA aqueous solution;

[0049] Low temperature stress treatment: treatment at 4°C.

[0050] The leaves were taken before (0h), 1 hour after treatment, 3 hours after treatment, 7 hours after treatment, 12 hours after treatment and 24 hours after treatment; the total RNA of leaves was extracted, and the expression of TaMYB19 gene was detected by RT-PCR The target fra...

Embodiment 3

[0054] Embodiment 3, the acquisition of transgenic plants and the identification of stress tolerance

[0055] 1. Using Gateway technology to construct overexpression vectors

[0056] 1. attB primer design

[0057] Primer Primer5.0 software was used to design primers for amplifying the coding region of TaMYB19 gene. According to the requirements of Gateway technology for constructing expression vectors, attB1 and attB2 recombination sites were added to the 5' ends of the upstream primer (F1) and downstream primer (R1), respectively. The designed primer sequences are as follows:

[0058] F1: 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCT CGATGGGGAGGTCGCCGTG-3';

[0059] R1: 5'- GGGGACCACTTTGTACAAGAAAGCTGGGT CGTCTCATATGTACTGGCCTTCC-3'.

[0060] In the upstream primer, the attB1 recombination site is underlined. In the downstream primers, the attB2 recombination site is underlined.

[0061] 2. Extract the total RNA of Chinese spring wheat and reverse transcribe it into cDNA.

[0062]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant stress tolerance related protein TaMYB19, and a coding gene and application thereof. The protein is the following (a) or (b): (a) a protein formed by amino acid sequences shown in Sequence 1 in a sequence table; and (b) a protein which is formed by the substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequences in Sequence 1, is related to plant stress tolerance and is derived from Sequence 1. The method has great theoretical and practical significance in study of plant stress tolerance molecule mechanisms, selection of plant stress tolerance varieties and plant stress tolerance molecule breeding, and provides an economical, quick and effective approach for improving the plant stress tolerance. The protein has extensive application and market prospects in the agriculture field.

Description

technical field [0001] The invention relates to a plant stress tolerance-related protein TaMYB19, its coding gene and application. Background technique [0002] Water scarcity and soil salinization are serious facts facing global agricultural production. Due to frequent droughts, the average annual drought-affected area in my country is 327 million mu. With global warming, the drought will become more and more serious, and the area of ​​farmland threatened by drought may exceed 700 million mu. According to estimates, abiotic stresses such as drought, low temperature, and salinity have an impact on crop yields of up to 40%. Water shortages in major grain-producing areas in northern my country reduce yields by 70-80 billion kilograms each year; Frequent occurrence, for example, the drought-affected area of ​​Guangdong every year exceeds 7.5 million mu; the drought-affected area of ​​crops in Sichuan Province in 2006 reached 21 million mu, accounting for 35% of the sown area, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/21C12N15/82A01H5/00
Inventor 孔秀英张立超赵光耀贾继增刘旭
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com