Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
A gene and coding technology, applied to the plant stress tolerance related protein TaMYB19 and its encoded gene and application fields, can solve the problems of complex plant stress resistance mechanism, achieve broad application and market prospects, and improve the effect of stress tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1, discovery of TaMYB19 protein and its coding gene
[0042] In order to study the function of wheat MYB gene in plant stress resistance, 60 genes encoding wheat MYB protein were screened from 30,000 non-redundant wheat full-length cDNA sequences sequenced in the laboratory by bioinformatics method. The expression patterns of 60 wheat MYB genes under stress conditions were studied by semi-quantitative PCR, and the genes induced by stress were screened out.
[0043] The protein shown in Sequence 1 of the Sequence Listing is named TaMYB19 protein, which consists of 247 amino acid residues. The gene encoding the TaMYB19 protein is named TaMYB19 gene, and its open reading frame is shown in the sequence 2 of the sequence listing from the 58th to the 798th nucleotide at the 5' end (741bp).
Embodiment 2
[0044] Embodiment 2, the expression pattern of TaMYB19 gene under stress conditions
[0045] Chinese spring wheat at two-leaf-one-heart stage was treated with low temperature stress and abscisic acid stress. Chadian red wheat at the two-leaf and one-heart stage was subjected to salt stress treatment. Hanxuan No. 10 wheat at the stage of two leaves and one heart was subjected to drought stress treatment.
[0046] Salt stress treatment: treatment with 250mM NaCl aqueous solution;
[0047] Drought stress treatment: process with 16.1% PEG aqueous solution;
[0048] Abscisic acid stress treatment: process with 200uM ABA aqueous solution;
[0049] Low temperature stress treatment: treatment at 4°C.
[0050] The leaves were taken before (0h), 1 hour after treatment, 3 hours after treatment, 7 hours after treatment, 12 hours after treatment and 24 hours after treatment; the total RNA of leaves was extracted, and the expression of TaMYB19 gene was detected by RT-PCR The target fra...
Embodiment 3
[0054] Embodiment 3, the acquisition of transgenic plants and the identification of stress tolerance
[0055] 1. Using Gateway technology to construct overexpression vectors
[0056] 1. attB primer design
[0057] Primer Primer5.0 software was used to design primers for amplifying the coding region of TaMYB19 gene. According to the requirements of Gateway technology for constructing expression vectors, attB1 and attB2 recombination sites were added to the 5' ends of the upstream primer (F1) and downstream primer (R1), respectively. The designed primer sequences are as follows:
[0058] F1: 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCT CGATGGGGAGGTCGCCGTG-3';
[0059] R1: 5'- GGGGACCACTTTGTACAAGAAAGCTGGGT CGTCTCATATGTACTGGCCTTCC-3'.
[0060] In the upstream primer, the attB1 recombination site is underlined. In the downstream primers, the attB2 recombination site is underlined.
[0061] 2. Extract the total RNA of Chinese spring wheat and reverse transcribe it into cDNA.
[0062]...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com