Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method

A technology of fluorescence quantification and reaction solution, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA preparation, etc., and can solve problems such as low amplification efficiency

Active Publication Date: 2012-05-23
BGI TECH SOLUTIONS
View PDF3 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, in order to make fluorescent quantitative PCR more suitable for the quantification of long nucleotide fragments, it is necessary to solve the problem of low amplification efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method
  • Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method
  • Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0040] Template preparation: Genomic DNA was extracted from the blood of a male yellow race, and a library was constructed according to "Preparing 2-5kb Samples for Mate Pair Library Sequencing Part#1005363Rev.B" (Part#1005363Rev.B), which contained different fragment sizes The concentration of the DNA was determined by Agilent 2100 Bioanalyzer, the concentration was 18.7nM, the average size of the deoxyribonucleic acid fragment was 557bp, and the size range of the deoxyribonucleic acid fragment was 391bp-637bp. The DNA library thus constructed was used as a standard, and the 1nM standard was diluted with deionized water to 5 concentrations: 0.1pM, 1pM, 10pM, 100pM and 1000pM, which were used as reaction templates. where 1nM=10 -9 mol / L, 1pM=10 -12 mol / L.

[0041] Hydrolysis probe sequence: 5'CCCTACACGACGCTCTTCCGATCT 3' (SEQ ID NO: 1), with a fluorescent group 5-FAM (5-carboxyfluorescein) at its 5' end, and a quencher group 6-TAMRA at its 3' end (6-carboxytetramethylrhodami...

Embodiment 1

[0046] Fluorescent quantitative PCR comparison of embodiment 1 reaction system optimization and commercialized reaction system

[0047] 1. The optimized reaction system is:

[0048] 1) Optimized reaction system 1:

[0049] 10×PCR Buffer 2.5μL

[0050] 2.5mM dNTPs 2μL

[0051] 100mM MgSO 4 0.25 μL

[0052] 10mg / mL BSA 0.25μL

[0053] 10% Tween-20 0.25 μL

[0054] 100% DMSO 1.25 μL

[0055] 5M Betaine (betaine) 5μL

[0056] 10 μM Primer 1.1 0.75 μL

[0057] 10 μM Primer 2.1 0.75 μL

[0058] 10μM hydrolysis probe 0.625μL

[0059] 50×ROX reference dye 0.5μL

[0060] DNA polymerase 0.25 μL

[0061] Template 1 μL

[0062] Deionized water 9.625μL

[0063] Total 25μL

[0064] Five standard concentrations were involved in the reaction, and each standard concentration was repeated twice.

[0065] 2) Optimized reaction system 2:

[0066] 10×PCR Buffer 2.5μL

[0067] 2.5mM dNTPs 2μL

[0068] 100mM MgSO 4 0.25 μL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of molecular biotechnology and experimental methods and specifically relates to a fluorescence quantitative PCR reaction solution. The solution is characterized by comprising a PCR reaction reinforcing agent which is one or more selected from the group consisting of dimethyl sulfoxide, glycerin, bovine serum albumin, methanamide, polyethylene glycol 6000, spermidine, ammonium sulfate and betaine, e.g., dimethyl sulphoxide, bovine serum albumin and betaine. The fluorescence quantitative PCR reaction solution further comprises heatproof DNA polymerase having 5'-3' polymerase activity and 5'-3' exonuclease activity and preferably comprises heatproof DNA polymerase and hot-start heatproof DNA polymerase, both of which having 3'-5' exonuclease activity. The invention also relates to a kit containing the reaction solution and a method of applying the reaction solution in fluorescence quantitative PCR.

Description

technical field [0001] The invention belongs to the field of molecular biology technology and experimental methods, in particular to a fluorescent quantitative PCR reaction solution and a fluorescent quantitative PCR method, in particular to a quantitative PCR reaction solution and method for long nucleotide fragments. Background technique [0002] Fluorescent quantitative PCR (Real-time quantitative PCR, also known as quantitative PCR, referred to as QPCR) technology refers to adding fluorescent groups to the PCR reaction system, using the accumulation of fluorescent signals to monitor the entire PCR process in real time, and finally using the standard curve to analyze the unknown template. methods for quantitative analysis. [0003] Fluorescent quantitative PCR can be divided into probe method and dye method according to different chemical principles. Among them, the Taqman fluorescence quantitative technology is based on the Taqman fluorescent probe. Taqman fluorescent ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10
CPCC12Q1/686C12N15/10C12Q1/6851
Inventor 张庆辉陈敏峰黄业博陈城超孙勇张秀清杨焕明
Owner BGI TECH SOLUTIONS
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More