Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving PCR (polymerase chain reaction) amplification efficiency

A technology of amplification efficiency and reaction system, which is applied in the direction of biochemical equipment and methods, microbe determination/inspection, etc., can solve the problems of low PCR amplification efficiency, low PCR sensitivity, and unsatisfactory amplification products, etc.

Pending Publication Date: 2020-05-12
SHENZHEN PEOPLES HOSPITAL
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] To some extent, in the process of PCR identification of trace samples, due to the extremely complex source of templates, a series of factors such as unsatisfactory amplification products and poor specificity will be faced, resulting in low efficiency of PCR amplification. low detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving PCR (polymerase chain reaction) amplification efficiency
  • Method for improving PCR (polymerase chain reaction) amplification efficiency
  • Method for improving PCR (polymerase chain reaction) amplification efficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The target sequence of the test is NCBI accession number NG_007992.1, which is the internal reference gene of actin. The outward primers for the first amplification are 5'ACCGCCGAGACCGCGTCCGC, as shown in SEQ ID 01, and 3'GTTGTCGACGACGAGCGCGGC, as shown in SEQ ID 02. The amplification conditions are initial denaturation at 95°C for 2 minutes, the first cycle stage is denaturation at 95°C for 35 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds, 18 cycles of amplification, and last extension at 72°C for 5 minutes, 16°C to restore. The primers for the second amplification are 5'GTGCAGAGCCGCCGTCTGG (inward to left), as shown in SEQ ID 03, and 5'GCAGGAAGTGCGCGCAAGCGCC (inward to right), as shown in SEQ ID 04. The second cycle stage is denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, 18 cycles of amplification, and finally extension at 72°C for 5 minutes, and recovery at 16°C.

[0023] A comm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for improving PCR (polymerase chain reaction) amplification efficiency. An AMP (2-amino-2-methyl-1-propanol) buffer is added into a reaction system, and the amplification efficiency is high.

Description

technical field [0001] The invention relates to a method for improving PCR amplification efficiency, which belongs to the field of biotechnology. Background technique [0002] At present, PCR technology has developed into an important detection technology in modern molecular biology, and plays an extremely important role in the process of molecular detection and diagnosis. PCR technology can amplify trace signaling molecules, which is beneficial to the detection of downstream signaling pathways. Using PCR for detection can amplify the signal by millions of times and realize the detection of trace target genes. [0003] To some extent, in the process of PCR identification of trace samples, due to the extremely complex source of templates, a series of factors such as unsatisfactory amplification products and poor specificity will be faced, resulting in low efficiency of PCR amplification. The detection sensitivity is low. Contents of the invention [0004] The invention p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686
CPCC12Q1/686
Inventor 张其清江一波林璐琳葛树娜
Owner SHENZHEN PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com