Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection
A protein molecule and human-derived technology, applied in the field of human applied basic medicine, can solve the problems of HIRRP protein function reporting and achieve good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] —Acquisition method of HIRRP protein molecules:
[0063] (1) Sample preparation: 24 hours after HSV1 infection, the infected and uninfected L02 cells were collected respectively, and the cell samples were processed according to the kit operation (Promega);
[0064] (2) Two-dimensional electrophoresis (Two2dimensioD Gel Electrophoresis, 2-DE). 300 μg of total cell protein was extracted as the loading sample, and 350 μl of hydration loading buffer was used to swell the IPG strip. The focusing electrophoresis program is: 50V, active hydration for 16 hours; after desalting and boosting process, 10000V focusing for 60000 volt hours. After the focusing is completed, equilibrate in the equilibrium solution for 15 minutes. The gel strips were transferred to the upper end of 12% SDS2PAGE gel for the second dimension protein separation. Start electrophoresis with a low voltage of 70V for 30min, then increase the voltage to 180V, and stop electrophoresis when bromophenol blue r...
Embodiment 2
[0082] ——Clone of HIRRP protein molecule
[0083] Method: HIRRP molecules are basically not expressed in the basic state or physiological level of cells, so the present invention uses 293 cell samples infected with HSV1 virus as a template for amplification.
[0084] (1) Construction of pcDNA3-HIRRP: 293 cell cDNA was used as amplification template, HIRRP-F and HIRRP-R were used as upstream and downstream primers, and the hirrp gene encoding HIRRP protein was obtained by PCR, which was digested by EcoRI and XhoI and then ligated into pcDNA3. The recombinant plasmid was identified by enzyme digestion and sequencing.
[0085] F: aatgaattcatggagcggctccgggagc
[0086] R: atagtcgacagcctgctctcagcttttg
[0087] (2) Construction of pcDNA3-HIRRP-N: Using pcDNA3-HIRRP as a template, pcDNA3-HIRRP-N-terminal F and R as upstream and downstream primers, the gene encoding HIRRP 1-140aa was obtained by PCR, after double digestion with EcoRI and XhoI Connected into pcDNA3, the recombinant p...
Embodiment 3
[0099] ——Expression of HIRRP protein
[0100] method:
[0101] (1) Construction and identification of pGEX-HIRRP: Using pcDNA3-HIRRP as a template, F and R of pGEX-HIRRP as upstream and downstream primers, the hirrp gene was obtained by PCR, and then ligated into pGEX-5X after EcoR I and Sal I double enzyme digestion -1, the recombinant plasmid was identified by enzyme digestion and sequencing.
[0102] (2) A 630bp band was digested by EcoRI and Sal I, and the pGEX-HIRRP recombinant plasmid was successfully constructed by bidirectional sequencing.
[0103] F: aatgaattcatggagcggctccgggagc
[0104] R: atagtcgacagcctgctctcagcttttg
[0105] (3) Expression and purification of HIRRP protein in prokaryotic cells:
[0106] Induction of Escherichia coli Transformed with pGEX-HIRRP Plasmid to Express Foreign Proteins
[0107] ①Transform competent cells BL21(DE3) with plasmids pGEX-5X-1 (as control bacteria) and pGEX-HIRRP respectively, spread the transformed bacteria on LB plates c...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap