Exonuclease III/I protection analysis based fluorescent biosensor method for detecting single nucleotide polymorphism
A single nucleotide polymorphism and exonuclease technology, applied in biochemical equipment and methods, fluorescence/phosphorescence, material excitation analysis, etc., can solve the problem of high analysis cost, achieve fast and easy operation, rapid automation, The effect of small amount of sample
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0019] Example 1: Based on exonuclease III / I protection analysis, it is used for mutation detection of β-thalassemia 654 site
[0020] 1) Allele-specific extension of a single deoxynucleotide labeled with biotin: the total volume of the base extension reaction is 25 L, and it is carried out in four different PCR tubes, wherein each tube includes the target strand to be detected, 5pmol of hairpin oligonucleotide probe primers, the primer sequence is GAA TTC CAA GCG CGA AG TTTT CTT CGC GCT TGG AAT TC TTTTTTCAC CAT TCT AAA GAA TAA CAG TGA TAA TTT CTG GGT TAA GG, 50pmol of four kinds of Biotin- A base of dNTP (Invitrogen), 2unit Taq DNA polymerase (NEB), 1×Tap DNA polymerase standard buffer solution (10mM Tris-HCL (pH 8.6), 50mM KCL, 1.5mM MgCL 2 ), the reaction was carried out in a 200μL PCR tube, denatured at 94°C for 3min, denatured at 94°C for 30s, annealed at 62°C for 30s, and extended at 68°C for 10s, for a total of 20 cycles, and finally stayed at 4°C. The product after ext...
Embodiment 2
[0024] Embodiment 2: Based on exonuclease III / I protection analysis, it is used for the mutation detection of the 12th codon of K-ras gene
[0025] 1) Allele-specific extension of a single deoxynucleotide labeled with biotin: the total volume of the base extension reaction is 25 L, and it is carried out in four different PCR tubes, wherein each tube includes the target strand to be detected, The hairpin oligonucleotide probe primer of 5pmol, primer sequence is (GAA TTC CAA GCG CGA AG TTTT CTT CGC GCT TGG AAT TCTTTTTTGAATAAACTTGTGGTAGTTGGAGCTG), a kind of base of four kinds of Biotin-dNTP (Invitrogen) of 50pmol, 2unit Taq DNA polymerase (NEB), 1×Tap DNA polymerase standard buffer solution (10mM Tris-HCL (pH 8.6), 50mM KCL, 1.5mM MgCL 2 ), the reaction was carried out in a 200 μL PCR tube, denatured at 94°C for 3 min, denatured at 94°C for 30 s, annealed at 65°C for 30 s, and extended at 72°C for 10 s, for a total of 20 cycles, and finally stayed at 4°C. The extended product wa...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com