Vascular endothelial growth factor specifically combined with collagen and application thereof
A vascular endothelium and growth factor technology, which is applied in cardiovascular system diseases, peptide/protein components, medical preparations containing active ingredients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, the preparation of recombinant protein VEGF-CBD
[0039] Human VEGF 165 The cDNA sequence (GenBank number: 7422) was used to design PCR amplification primers, and the coding sequence "ACTAAGAAAAACCCTGCGTACT" of the collagen binding domain (CBD) "TKKTLRT" was introduced into the downstream primers.
[0040] The primer sequences are as follows:
[0041] Upstream primers:
[0042] S1: 5'-ATTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG-3';
[0043] S2: 5'-CTTTAAGAAGGAGATATACCATGGCACCCATGGCAGAAGGAGG-3'.
[0044] Downstream primers:
[0045] X1: 5'-TACTCGAGAGTACGCAGGGTTTTTCTTAGTACCGCCAGAACCCGCAGCACTGC-3';
[0046] X2: 5'-GCCAGAACCCGCAGCACTGCCCGCGCTACCCCGCCTCGGCTTGTCACATC-3';
[0047] X3: 5'-TACTCGAGCCGCCTCGGCTTGTCACATCT-3'.
[0048] The total RNA of the breast cancer tumor cell line MCF-7 was extracted by TRizol method, reverse-transcribed into cDNA, and the cDNA was used as a template, and S2 and X2 were used as primers to amplify, and the obtained fragme...
Embodiment 2
[0052] Example 2, Analysis of VEGF-CBD and VEGF respectively binding to collagen
[0053] a) Binding experiments of VEGF-CBD and VEGF to collagen respectively
[0054] Rat tail collagen was extracted as follows:
[0055] Stir the rat tail with a neutral salt solution (0.1M Tris, 0.2M Nacl, 0.1M EDTA, PH 7.6) for 3 hours, then centrifuge at 12000g for 30 minutes, discard the supernatant, and dissolve the precipitate in 0.5M acetic acid solution overnight. Then centrifuge at 13000g for 1 hour, discard the precipitate, add the same amount of 4M Nacl solution to the supernatant, precipitate for 20 minutes, then centrifuge at 13000g for 30 minutes, collect the precipitate, redissolve it in 0.2M acetic acid, and dialyze to remove Nacl to obtain collagen solution.
[0056] The method of combining VEGF-CBD and VEGF with collagen respectively is as follows:
[0057] 1) The collagen solution prepared above was made into a 100 μg / ml solution with PBS, added to a 96-well ELISA plate at...
Embodiment 3
[0069] Embodiment 3, the biological activity of VEGF-CBD
[0070] Isolation and culture of human umbilical cord endothelial cells: the isolated human umbilical cord is washed with PBS buffer to remove blood cells, and then 0.25% trypsin is poured into the umbilical cord, both sides are closed with hemostats, placed at 37 degrees for 15 minutes, and then trypsin The digested liquid was collected, and the inner wall was washed dozens of times with PBS, and the liquid was collected together. After centrifugation, the cells obtained were cultured in the M199 medium of 20% fetal bovine serum, 10ng / ml VEGF and 10ng / ml bFGF, and immediately after expansion. human umbilical cord endothelial cells.
[0071] In order to measure the biological activity of VEGF-CBD, the above-mentioned isolated human umbilical cord endothelial cells were cultured in 48-well cell culture plates, and equimolar (0, 1, 2, 3, 4 and 5 nM) CBD-VEGF or VEGF were added, three The proliferation of cells was detect...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com