Supercharge Your Innovation With Domain-Expert AI Agents!

Vascular endothelial growth factor specifically combined with collagen and application thereof

A vascular endothelium and growth factor technology, which is applied in cardiovascular system diseases, peptide/protein components, medical preparations containing active ingredients, etc.

Active Publication Date: 2010-03-17
YANTAI ZHENGHAI BIO TECH +1
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after protein injection, due to the flushing of body fluids, the factors quickly diffuse, making it difficult to meet the treatment requirements in local concentrations. If a large amount of injections will have negative effects on organisms, gene therapy has potential safety hazards.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vascular endothelial growth factor specifically combined with collagen and application thereof
  • Vascular endothelial growth factor specifically combined with collagen and application thereof
  • Vascular endothelial growth factor specifically combined with collagen and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, the preparation of recombinant protein VEGF-CBD

[0039] Human VEGF 165 The cDNA sequence (GenBank number: 7422) was used to design PCR amplification primers, and the coding sequence "ACTAAGAAAAACCCTGCGTACT" of the collagen binding domain (CBD) "TKKTLRT" was introduced into the downstream primers.

[0040] The primer sequences are as follows:

[0041] Upstream primers:

[0042] S1: 5'-ATTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG-3';

[0043] S2: 5'-CTTTAAGAAGGAGATATACCATGGCACCCATGGCAGAAGGAGG-3'.

[0044] Downstream primers:

[0045] X1: 5'-TACTCGAGAGTACGCAGGGTTTTTCTTAGTACCGCCAGAACCCGCAGCACTGC-3';

[0046] X2: 5'-GCCAGAACCCGCAGCACTGCCCGCGCTACCCCGCCTCGGCTTGTCACATC-3';

[0047] X3: 5'-TACTCGAGCCGCCTCGGCTTGTCACATCT-3'.

[0048] The total RNA of the breast cancer tumor cell line MCF-7 was extracted by TRizol method, reverse-transcribed into cDNA, and the cDNA was used as a template, and S2 and X2 were used as primers to amplify, and the obtained fragme...

Embodiment 2

[0052] Example 2, Analysis of VEGF-CBD and VEGF respectively binding to collagen

[0053] a) Binding experiments of VEGF-CBD and VEGF to collagen respectively

[0054] Rat tail collagen was extracted as follows:

[0055] Stir the rat tail with a neutral salt solution (0.1M Tris, 0.2M Nacl, 0.1M EDTA, PH 7.6) for 3 hours, then centrifuge at 12000g for 30 minutes, discard the supernatant, and dissolve the precipitate in 0.5M acetic acid solution overnight. Then centrifuge at 13000g for 1 hour, discard the precipitate, add the same amount of 4M Nacl solution to the supernatant, precipitate for 20 minutes, then centrifuge at 13000g for 30 minutes, collect the precipitate, redissolve it in 0.2M acetic acid, and dialyze to remove Nacl to obtain collagen solution.

[0056] The method of combining VEGF-CBD and VEGF with collagen respectively is as follows:

[0057] 1) The collagen solution prepared above was made into a 100 μg / ml solution with PBS, added to a 96-well ELISA plate at...

Embodiment 3

[0069] Embodiment 3, the biological activity of VEGF-CBD

[0070] Isolation and culture of human umbilical cord endothelial cells: the isolated human umbilical cord is washed with PBS buffer to remove blood cells, and then 0.25% trypsin is poured into the umbilical cord, both sides are closed with hemostats, placed at 37 degrees for 15 minutes, and then trypsin The digested liquid was collected, and the inner wall was washed dozens of times with PBS, and the liquid was collected together. After centrifugation, the cells obtained were cultured in the M199 medium of 20% fetal bovine serum, 10ng / ml VEGF and 10ng / ml bFGF, and immediately after expansion. human umbilical cord endothelial cells.

[0071] In order to measure the biological activity of VEGF-CBD, the above-mentioned isolated human umbilical cord endothelial cells were cultured in 48-well cell culture plates, and equimolar (0, 1, 2, 3, 4 and 5 nM) CBD-VEGF or VEGF were added, three The proliferation of cells was detect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vascular endothelial growth factor specifically combined with collagen and an application thereof. The vascular endothelial growth factor specifically combined with collagenis a recombination protein obtained by fusing a collagen combination domain with the amino terminal or carboxyl terminal of the vascular endothelial growth factor by connecting peptide; and the aminoacid sequence of the collagen combination domain is the sequence 2 in a sequence list from the amino terminal position 178 to position 184. The invention also discloses an encoding gene of the vascular endothelial growth factor specifically combined with the collagen. The vascular endothelial growth factor specifically combined with the collagen is favorable for solving the problems of low activity and high risk caused by the indiffusion of the vascular endothelial growth factor, and provides a new method for repairing myocardial damage.

Description

technical field [0001] The invention relates to a vascular endothelial growth factor specifically combined with collagen and its application. Background technique [0002] Vascular endothelial growth factor (VEGF) is a class of cysteine-rich glycoproteins, including VEGF-A, VEGF-B, VEGF-C, VEGF-D, and VEGF-E, which have specific signal peptides that can be secreted to function outside the cell. of which VEGF 165 The most widely used, it can promote the proliferation and differentiation of vascular endothelial cells, inhibit the apoptosis of endothelial cells and promote the migration of vascular smooth muscle cells and other functions (Ferrara N, Houck K, JakemanL, Leung DW. Molecular and biological properties of the vascular endothelial growth factor family of proteins.Endocr Rev.1992;13(1):18-32.YancopoulosGD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J.Vascular-specific growth factors and blood vessel formation.Nature.2000;407( 6801): 242-248.). In the treatment ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A61K38/17A61P9/00A61P9/10
Inventor 戴建武张晶赵燕南陈冰
Owner YANTAI ZHENGHAI BIO TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More