Supercharge Your Innovation With Domain-Expert AI Agents!

Method for measuring sortase based on yeast surface display

A technology of surface display and detection method, applied in the field of enzyme analysis, can solve the problems of high cost and complicated operation, and achieve the effect of low price, simple operation and cost reduction.

Inactive Publication Date: 2009-12-16
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method further improves the accuracy, but still does not solve the problem of high cost and more complicated operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for measuring sortase based on yeast surface display
  • Method for measuring sortase based on yeast surface display
  • Method for measuring sortase based on yeast surface display

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A sorting enzyme detection method based on yeast surface display sorting enzyme substrate, which includes the following steps:

[0035] 1. According to the staphylococcus aureus sortase that can recognize the conserved motif LPXTG contained in the C-terminal sorting signal of the surface protein, pcDNA6-myc-his-EGFP is used as the template, and the primer is 5’-CCCACGCGTATG CAAGCTTTGCCTGAAACTGGTGAAG AA GGAGGAATTGGAATTGCTC-3’ and

[0036] 5’-CGCGAATTCTTACTTGTACAGCTCGTCCATG-3’, the underlined part is the substrate QALPETGEE gene, and the target gene QALPETGEE and linker-eGFP gene are fused to form QALPETGEE-linker-eGFP;

[0037] 2. Construction of QALPETGEE-linker-eGFP expression vector: The expression vector pKFS (modified pPIC9K, added flocculin gene, named pKFS, see the Chinese invention patent with application number 200810028631) and the target gene QALPETGEE-linker -eGFP was digested with double restriction enzymes to construct the vector pKFS-QALPETGEE-linker-eGFP. ...

Embodiment 2

[0044] A sorting enzyme detection method based on yeast surface display sorting enzyme substrate, which includes the following steps:

[0045] 1. According to the staphylococcus aureus sortase that can recognize the conserved motif LPXTG contained in the C-terminal sorting signal of the surface protein, pcDNA6-myc-his-EGFP is used as the template, and the primer is 5’-CCCACGCGTATG CAAGCTTTGCCTGAAACTGGTGAAG AA GGAGGAATTGGAATTGCTC-3’ and

[0046] 5’-CGCGAATTCTTACTTGTACAGCTCGTCCATG-3’, the underlined part is the substrate QALPETGEE gene, and the target gene QALPETGEE and linker-eGFP gene are fused to form QALPETGEE-linker-eGFP;

[0047] 2. Construction of QALPETGEE-linker-eGFP expression vector: The expression vector pKFS (modified pPIC9K, added the flocculin gene, named pKFS, see the Chinese invention patent with application number 200810028631) and the target gene QALPETGEE-linker -eGFP was digested with double restriction enzymes to construct the vector pKFS-QALPETGEE-linker-eG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for measuring sortase based on pichia pastoris surface display, comprising the following steps: A. infusing target gene QALPETGEE and linker-eGFP gene into QALPETGEE-linker-eGFP; B. constructing an expression carrier for constructing QALPETGEE-linker--eGFP; C. converting the expression carrier pKFS-QALPETGEE-linker-eGFP into pichia pastoris; D. expressing yeast surface protein: inoculating and culturing positive transformant by YPD and BGMY liquid culture medium, and inducing expression in BMMY liquid culture medium; E. measuring the yeast surface protein; F. expressing sortase; and G. testing activatedly the sortase. The invention uses the yeast surface display technology, fluorospectrophotometer and flow cytometry are adopted for measuring, and the used materials are lower in price, thus greatly reducing the measuring cost of sortase and facilitating operation.

Description

Technical field [0001] The invention relates to the technical field of enzyme analysis, in particular to a sorting enzyme detection method based on yeast surface display sorting enzyme substrates. Background technique [0002] The cysteine ​​transpeptidase of the sorting enzyme is a key enzyme that anchors the surface proteins of many Gram-positive bacteria to the cell wall. Mazmanian et al. found that it can be fixed on the cell membrane through the N-terminal part of the peptide chain, and can recognize the conservative amino acid motif LPXTG contained in the C-terminal sorting signal of the surface protein, thereby anchoring the surface protein to the cell wall (Staphylococcusaureus sortase, an enzyme that anchors surface proteins to the cellwall. Science, 1999, 285(5428): 760~763). The surface protein can play a key role in the pathogenicity of pathogenic bacteria, so the sorting enzyme may be called a drug target to reduce the pathogenicity of gram-positive bacteria. The est...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/48C12N15/81C12P21/02C12N15/70C12N9/10C12R1/84C12R1/19
Inventor 罗立新吴琳朱芳江彬强林影
Owner SOUTH CHINA UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More