Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-efficiency rapid bladder cancer urinalysis kit and urinary cell active preservative fluid

A technology for urine cells and preservation solution, applied in the field of biomedicine, can solve the problem of inability to accurately quantitatively detect substrates and other problems

Active Publication Date: 2009-12-16
同昕生物技术(北京)有限公司
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Combined with the method of adding internal standards, such as the patent application with the patent number 00111629.0 and the name "Quantitative Assay Method for Telomerase Activity", the technical solution provides very ideal primers, internal reference primers and internal standard templates, which can well avoid Due to defects such as false negative results and non-specific amplification caused by primer dimers, since the fluorescent quantitative PCR technology had not been developed at that time, it was impossible to accurately and quantitatively detect the substrate, but combined with modern PCR fluorescent technology, it will be able to detect sensitively and specifically Quantification of telomerase activity in cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency rapid bladder cancer urinalysis kit and urinary cell active preservative fluid
  • High-efficiency rapid bladder cancer urinalysis kit and urinary cell active preservative fluid
  • High-efficiency rapid bladder cancer urinalysis kit and urinary cell active preservative fluid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1. Preparation of urine cell activity preservation solution and application test

[0057] Step 1: Preparing the preservation solution, according to the ingredients listed in Table 1, the solvent is double distilled water, pH7.2-7.4.

[0058] The obtained preservation solution is named: Cellock solution.

[0059] Table 1

[0060] Element

Proportion

source of ingredients

epidermal growth factor

0.08ng / mL

Commercially available, Sigma / E9644

BSA Albumin

0.5% (w / w)

commercially available

dimethyl sulfoxide

3% (w / w)

commercially available

Dulbecco's Phosphate

salt buffer

(DPBS)

0.18mg / mL

Commercially available from Sigma, pH 7.2-7.4, including potassium dihydrogen phosphate

Potassium Phosphate monobasic

(KH2PO4), 1.47mM and Disodium Hydrogen Phosphate Sodium

Phosphate dibasic (Na2HPO4-7H2O),

8.06mM, Calciu...

Embodiment 2

[0068] Embodiment 2 assembles kit

[0069] Reagents used Taq polymerase and 10X Taq polymerase buffer, 50X dNTP Mix * , trypsin-versene (EDTA), and chemicals for preparing PBS buffers are commercially available.

[0070] Table 2

[0071] Kit ingredients:

1.Cellock solution (obtained by embodiment 1)

2. Reaction mixture

FP primer 100ng / μL

RP primer 100ng / μL

CP primer 100ng / μL

ICT template 0.01 amol / μL

50X dNTP Mix *

Taq polymerase 2Units / μL

10XTaq Polymerase Buffer

PCR grade water

3. Positive control standard: 250cells / μL

[0072] 1. The primer sequence is as follows, synthesized by the biological company:

[0073] FP: 5'[FAM]ATTGCCAATCCGTCGAGCAGAGTT[-DABSYL]

[0074] RP: 5'GCGCGGCTTACCCCTTACCCTTACCCTAACC

[0075] CP: 5'[ROX]ATCGCTTCTCGGCCTTT[-DABSYL]

[0076] ITC: 5'AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT

[0077] 2.PCR grade water: deionized water, no protease, DNase and RNase pollution....

Embodiment 3

[0083] Embodiment 3. The method for using the kit of the present invention

[0084] Step 1 template preparation;

[0085] (1) Take 200mL of the first morning urine of 10 pathological cases, add 2ml of Cellock solution for the first time according to the ratio of urine:preservation solution 100:1, centrifuge at 2000g at room temperature for 30min to precipitate urine sample cells; discard the supernatant , then add 10ml, Cellock solution to resuspend the urine sample cells, and the resuspension enters the next step of detection or stores at -75°C;

[0086] (2) Take 2ml of the urine sample cell suspension obtained in the previous step, centrifuge at 8000g at 4°C for 5min, discard the supernatant as much as possible;

[0087] (3) Add 20ul 1X cell lysate (recipe is the same as 2.2 in Example 1), and obtain urine cell samples from 10 cases respectively.

[0088] Step 2. Detection process design

[0089] To test 10 (n) samples, then each test will consist of 24 PCR reactions (2n+...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-efficiency rapid bladder cancer urinalysis kit and a urinary cell active preservative fluid, which belong to the field of biomedicine. The high-efficiency rapid bladder cancer urinalysis kit contains the urinary cell active preservative fluid and a specific fluorescence labeled primer for detecting the activity of telomerase. The kit can perform detection of the activity of the telomerase on cells taken from urine further to efficiently and accurately detect whether a patient suffers from diseases related to the activity of the telomerase such as bladder cancer; the urinary preservative fluid in the kit is a key factor; the activity of the telomerase of an early cancer patient has lower expression level, the activity of the telomerase is difficult to detect in a small amount of tested cells, and the urinary preservative fluid can ensure that collected urinary cells preserve good activity so as to provide adequate time for acquiring adequate active cells; and the high-efficiency rapid bladder cancer urinalysis kit and the urinary cell active preservative fluid provide a feasible way for accurately detecting early bladder cancer and non-invasively monitoring the bladder cancer.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to an efficient and rapid bladder cancer urine test kit and urine cell activity preservation solution. Background technique [0002] Urine samples contain physiological metabolic waste substances, including organic and inorganic components and electrolyte components containing trace elements. Some urine will contain proteins and carbohydrates, which are pathological metabolites; A series of tissues such as the bladder, therefore, urine also contains a small amount of tissue exfoliated cells. In view of the close relationship between urine and human metabolism, it is used in many analytical experiments or clinical tests. However, it is precisely because of the rich components in the urine sample that the bacteria can rapidly multiply in it. When the urine sample cannot enter the detection procedure in time, the bacteria and some of the components will inactivate the components that reflect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N1/02C12Q1/68
Inventor 程根宏焦守恕
Owner 同昕生物技术(北京)有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products