Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use
A hepatitis C virus, molecular nucleotide technology, applied in the field of microbial infection immunity and inspection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0069] A DNA aptamer capable of binding and inhibiting hepatitis C virus infection has the nucleotide sequence shown in SEQ ID NO. (1-29).
[0070] A method for preparing a DNA aptamer capable of binding and inhibiting hepatitis C virus infection is carried out in the following steps:
[0071] 1. Construction of random single-stranded DNA (ssDNA) library and primers. Construct a single-stranded DNA (ssDNA) library with a length of 88 bases: 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N 30 -GGGTCAATGCGTCATA-3', wherein N represents any one of the bases A, G, T, and C, and the capacity of the library is about 10 14 ~10 15 ; Construct upstream primer: 5'-GCGGAATTC TAATACGACTCACTATAGGG AACAGTCCGAGCC-3', where the underlined part is the sequence of the T7 promoter, the primer contains a DNA restriction endonuclease EcoRI restriction site; construct a downstream primer: 5'-GCGGGATCCTATGACGCATTGACCC-3', the primer contains a DNA restriction The cleavage site of the sex endonucl...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com