Supercharge Your Innovation With Domain-Expert AI Agents!

Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment

A lupus erythematosus, systemic technology, applied in gene therapy, allergic diseases, DNA/RNA fragments, etc., can solve the problems of not knowing the impact of immune diseases, not reporting the relationship between systemic lupus erythematosus, etc.

Active Publication Date: 2009-03-04
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although it has been reported that miR-146 plays an important role in the immune response, its influence on some specific immune diseases is still unknown in the art, let alone its relationship with systemic lupus erythematosus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment
  • Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment
  • Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0175] Example 1 There are differences in the expression levels of a group of miRNAs between SLE patients and normal controls

[0176] In order to explore the role of miRNAs in SLE, the inventors used Real-time PCR to study the differences in the expression levels of 156 mature miRNAs in the peripheral blood of SLE patients and normal controls.

[0177] It was found that the expression levels of 42 miRNAs in SLE patients were significantly lower than those of normal people, and the expression levels of 7 miRNAs including miR-146a were reduced by more than 6 times, see figure 1 A and Table 1.

[0178] Table 1

[0179] name Sequence (GenBank accession number) SEQ ID NO: miR-146a 5'UGAGAACUGAAUUCCAUGGGUU 3'(MI0000477) 2 miR-130b 5'CAGUGCAAUGAUGAAAGGGCAU 3'(MI0000748) 4 miR99a 5'AACCCGUAGAUCCGAUCUUGUG 3'(MI0000101) 5 miR-10a 5'UACCCUGUAGAUCCGAAUUUGUG 3'(MI0000266) 6 miR-134 5'UGUGACUGGUUGACCAGAGGGG 3'(MI0000474) 7 miR-31 ...

Embodiment 2

[0182] Example 2 miR-146 expression signal is negatively correlated with disease activity and kidney involvement

[0183] According to the previous data results of the present inventors, the correlation between the expression level of miR-146a and diseases was further studied.

[0184] The results showed that miR-146a in SLE patients was significantly lower than that in the normal control group, and the non-parametric Mann-Whitney test showed that the difference was statistically significant (all P values ​​ figure 2 a.

[0185] The level of miR-146a in the active group of SLE patients (SLEDAI score ≥ 5) was significantly lower than that in the stable group (SLEDAI score 0-4 points), and the non-parametric Mann-Whitney test showed that the difference was statistically significant (P=0.0080), see figure 2 a.

[0186] On this basis, further application of Spearman one-tailed correlation test found that there was a negative correlation between the SLEDAI score and miR-146a (r=-...

Embodiment 3

[0189] Example 3 The level of miR-146a is related to the overactivation of type I interferon pathway

[0190] Existing research results have shown that the activation of IRAK1 and TRAF6 can lead to the production of downstream type I interferon through various signaling pathways, and the type I interferon pathway plays a key role in the pathogenesis of lupus. The inventors reflected the degree of activation of the type I interferon pathway in patients by detecting the mRNA expression levels of three representative genes downstream of the type I interferon, and explored the relationship between the decreased expression level of miR-146a and the type I interferon pathway in SLE . The results of Spearman's two-tailed correlation test showed that there was a negative correlation between the expression level of miR-146a and the integral level of IFN (r=-0.3073, P=0.0378), see image 3 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnology field and discloses a purpose of small RNA; the small RNA is used to prepare a reagent or a reagent-box of SLE. The invention also discloses a test reagent or a test reagent-box used to test the level of the small RNA, thereby diagnosing the SLE. The invention initially discloses and proves that the small RNA and the SLE are closely related, so as to provide a new drug target for disease prevention; the regulation of the small RNA level is a novel curing means for disease obstruction.

Description

technical field [0001] The invention belongs to the field of biotechnology; specifically, the invention relates to methods and kits for diagnosing systemic lupus erythematosus, and the application of microRNA genes in the prevention and treatment of diseases related to abnormal activation of type I interferon pathway (such as systemic lupus erythematosus disease) . Background technique [0002] Systemic Lupus Erythematosus (SLE) is a typical non-organ-specific autoimmune disease, and its clinical and immunological phenotypes are extremely complex and diverse, including immune tolerance deficiency, lymphocyte function regulation and apoptosis disorders, and complement deficiency. And immune complex clearance disorders, cytokine secretion regulation disorders, etc., almost covering the entire immune system disorders, are recognized as the prototype of autoimmune diseases. At present, the pathogenesis of SLE has not been fully elucidated. Due to the unknown etiology and pathog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11A61K31/708A61P37/02C12N15/113
CPCC12Q2600/178C12N2320/12A61K31/7088C12N2310/141C12Q1/6883C12N15/113C12N15/111A61P37/00A61P37/02
Inventor 沈南唐元家崔慧娟罗晓兵倪旭鸣
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More