Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel function of c-Jun participating in classical Wnt signal transduction path

A technology of c-jun and nuclear localization signals, applied in the field of cell biology, can solve problems such as unclear transcription

Active Publication Date: 2013-06-05
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the transcription of c-Jun to target genes downstream of Wnt signaling dependent on the β-catenin / TCF transcription complex is unknown
[0008] In summary, although the canonical Wnt signaling pathway is now well understood, and it has been reported that c-Jun can form a transcription complex with β-catenin / TCF, the participation of c-Jun in the canonical Wnt pathway and its impact still needs further research. Research and Demonstration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel function of c-Jun participating in classical Wnt signal transduction path
  • Novel function of c-Jun participating in classical Wnt signal transduction path
  • Novel function of c-Jun participating in classical Wnt signal transduction path

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1c

[0095] Obtaining of embodiment 1c-Jun

[0096]The inventors used a protein consisting of amino acids 1-375 (called Dvl1-N7) of the Dvl1 protein (see SEQ ID NO: 2) as a "bait" to screen a 10.5-day mouse embryo bank by yeast two-hybrid ( Invitrogen). The two-hybrid system used was ProQuest TM Two-Hybrid System (purchased from Invitrogen), for specific experimental methods, see the instruction manual provided by the two-hybrid system. As a result, a c-Jun clone with deletion of 73 amino acids at the N-terminal was obtained.

Embodiment 2

[0097] Example 2c-Jun and Dvl protein interaction

[0098] 1. c-Jun can interact with three Dvl proteins in cells

[0099] For further research, the inventors designed primers at both ends of the human c-Jun gene and introduced XhoI and NotI restriction sites at the N-terminus and C-terminus respectively. The primers are:

[0100] Forward: CTAGCTCGAGGACTGCAAAGATGGAAAC (SEQ ID NO: 8)

[0101] Reverse: ATAAGAATGCGGCCGCTCAAAATGTTTGCAACT (SEQ ID NO: 9)

[0102] Using the human cDNA library prepared by conventional methods as a template, the sequence containing the full-length c-Jun was obtained by PCR reaction, and then double-digested with XhoI / NotI, and the digested products were respectively cloned into the XhoI of the pCMV vector (purchased from Bioscience) In the / NotI restriction site and in the SalI / NotI restriction site of pET28c, plasmids pCMV / c-Jun and pET28c / c-Jun, which can be expressed in eukaryotic cells and prokaryotic cells, respectively, were constructed.

[01...

Embodiment 3

[0120] The function of embodiment 3c-Jun in canonical Wnt signal transduction pathway

[0121] Mainly use the Topflash reporter gene activity system to detect.

[0122] The Topflash reporter gene comes from Upstate Company; the activity detection of the reporter gene adopts: Luciferase Reporter Gene Assay, High Sensitivity, from Roche Company, and the detection method refers to the instruction manual provided at the same time. According to the sequence of c-Jun, the siRNA sequence against c-Jun was designed as follows: 5'-GUCAUGAACCACGUUAACA dTdT-3' (SEQ ID NO: 10), which can be directly transfected.

[0123]Human embryonic kidney cell 293T cells and colon cancer cell SW480 cells (purchased from ATCC, which is a colon cancer cell line with APC protein function loss) were transfected with the above-mentioned reporter gene containing luciferase promoter region with Tcf binding site , green fluorescent protein, c-Jun small interfering RNA (siJun). After about 48 hours of transf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a screening method of a regulator which modulates the interaction between c-Jun protein and disheveled protein. The invention also discloses a matter which can inhibit the interaction between c-Jun protein and disheveled protein, namely, a Dvl 1-M polypeptide. The invention reveals the interaction between c-Jun protein and Dvl protein in the Wnt signal transduction pathway for the first time, thus affecting the downstream Wnt signal transduction. As abnormal activation of the downstream Wnt signal transduction in the pathway is closely related to the occurrence and development of tumor, so the method provides a new target for screening drugs inhibiting the occurrence and development of tumor.

Description

technical field [0001] The invention belongs to the field of cell biology, and specifically relates to an interacting protein in the canonical Wnt signal transduction pathway and its application. Background technique [0002] Signal transduction is one of the frontier fields of biological research. In recent years, it has been found that there is a very conserved signaling pathway among individuals of different races. Its signaling molecule is a kind of glycoprotein superfamily - Wnt protein, so it is called Wnt signaling pathway. The Wnt signaling molecule family includes 19 members in the human species. At present, it is found that the signal responses caused by different Wnt molecules are different, which are divided into the classic Wnt signal transduction pathway (Wnt / β-catenin), such as Wnt3 and Wnt8, and the non-canonical Wnt signaling pathway (Wnt / Ca 2+ and Wnt / JNK pathway), such as Wnt11 and Wnt5a. Among them, there are many studies on the canonical Wnt signaling...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47G01N33/68G01N33/00
Inventor 李林甘肖箐王计勇席莹
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products