Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Comamonas testosterone engineering bacteria and use thereof

A technology of Comamonas and testosterone, applied in application, genetic engineering, bacteria, etc.

Inactive Publication Date: 2008-11-12
FUJIAN AGRI & FORESTRY UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, no report has been found on the transformation of Comamonas testosteroni by DNA recombination technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Comamonas testosterone engineering bacteria and use thereof
  • Comamonas testosterone engineering bacteria and use thereof
  • Comamonas testosterone engineering bacteria and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment one, the construction method of engineering bacterium AMCa3 (CGMCC No.2364), comprises the following steps:

[0043] 1. Cloning of C.test activator gene

[0044] The total DNA of the bacteria was extracted from the overnight cultured C.test according to the method in the "Guidelines for Molecular Biology Experiments" and used as a template for PCR amplification. Using the chromosomal DNA of C.test as a template, primers were designed according to the sequence of the activator gene (kpn I and Sma I restriction sites and protective bases were added to the primers at both ends), and the primers were synthesized by Shanghai Bioengineering Co., Ltd. The activator gene was amplified by PCR with Ex Taq enzyme from Dalian TaKaRa Company.

[0045] Primer1(+) (forward primer): 5'TTT GTGCGCGCAGTGCACTTCCAC3'30bp;

[0046] Primer2(-) (reverse primer): 5'TTT TCAATGCTGCAGCCGGGCCGT3'30bp

[0047] PCR products were subjected to 1.0% agarose electrophoresis, such as f...

Embodiment 2

[0079] Embodiment two, the preparation of engineering bacterium AMCa3 (CGMCC No.2364) bacterium suspension and be applied to the method for degrading steroid compound, comprise the following steps:

[0080] 1. Activation culture of engineering bacteria AMCa3 (CGMCC No.2364) and preparation of bacterial suspension

[0081] Take 200 μL of AMCa3 (CGMCC No.2364) glycerol cells stored at -70°C, inoculate them in 3 mL of LB medium, add 60 μg / mL of ampicillin and 30 μg / mL of kanamycin for shaking overnight culture , the rotation speed is 180r / min, and the culture temperature is 30°C. The overnight culture was inoculated in fresh LB medium containing corresponding antibiotics at a ratio of 1:100, and cultured with shaking until OD 600 =1.0, 10,000r / min centrifugal 5min, collect thalline, be suspended in the M8 inorganic salt medium that does not add any steroid compound, or M9 inorganic salt medium, or LB medium, just make AMCa3 (CGMCC No.2364 ) bacterial suspension. Said steroid c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Comamonas testosteroni engineering bacterium. Directional regulation is adjusted and controlled to Comamonas testosterone through a DNA recombination technology, so as to produce Comamonas testosteroni AMCa 3 (CGMCC No.2364) having the capability of efficiently degrading steroid compounds. The engineering bacterium can effectively degrade testosterone, cholesterol and other steroid compounds, has good degradation effect to soils and livestock-poultry excreta seriously polluted by steroid compounds, and can be used for the treatment of livestock-poultry excreta, producing low-cholesterol food in food industry, and transforming steroid substances in the production of feed additives and dairy products for producing pollution-free food. The engineering bacterium has important significance in environmental remediation and agricultural application.

Description

[0001] Technical field The present invention relates to a kind of microorganism and its application, especially a Comamonas testosteroni engineering bacterium and its application to degrade steroid compounds. Background technique [0002] Since the 1980s, people have begun to notice reproductive disorders, abnormal development, and feminization of male individuals in wild animals in the western suburbs of Tokyo, southern England, and Florida. At present, more and more research results show that human reproductive disorders, abnormal development and certain cancers, such as breast cancer, testicular cancer and ovarian cancer, are closely related to the distribution level of endocrine disruptors in the environment. Among many environmental endocrine disrupting substances, the endocrine disrupting effect of steroid compounds is much higher than that of other endocrine disrupting substances. Compared with artificially synthesized chemical substances, they have a more significant im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/74B09C1/10A62D3/02C12S13/00C12R1/01A62D101/28C12S99/00
Inventor 潘大仁陈建秋周以飞
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com