Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Process for obtaining antimycosis cut flower flameray gerbera by transgene

A technology against fungi and gerbera, applied in genetic engineering, plant genetic improvement, botany equipment and methods, etc., can solve problems such as polluted environment, limited effectiveness, systemic fungicides cannot meet the requirements of flower production, etc.

Inactive Publication Date: 2008-10-22
FLOWER RES INST OF YUNNAN ACAD OF AGRI SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to factors such as polluting the environment, high cost, and limited effectiveness, physical or chemical soil sterilization and the use of systemic fungicides cannot meet the requirements of flower production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for obtaining antimycosis cut flower flameray gerbera by transgene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0065] specific implementation

[0066] In order to better illustrate the essence of the present invention, the following examples of the present invention are given, but the content of the present invention is not limited thereto.

[0067] Step 1, using kidney bean and tobacco as test materials to carry out the isolation, cloning and construction of expression vectors of Chi gene and Glu gene

[0068] (1) Isolation and cloning of genes

[0069] A, Chi gene amplification primers: According to the sequence of the bean chitinase cDNA sequence GenBank M13968 primers are designed as follows:

[0070] P 1 : 5'GAATGAGGCTTTGTAAATTCAC 3'

[0071] P 2 : 5'CGTTAATTTCCAAAAGACCTCTGGT 3'

[0072] B, Glu gene amplification primers: according to the tobacco glucanase cDNA sequence GenBank X53600 primers are designed as follows:

[0073] P 3 : 5'AAATGGCTGCTATCACACTCCTAG 3'

[0074] P 4 : 5'CGTCACCCAAAGTTGATATTATATTGG3'

[0075] The above 2 pairs of primers were synthesized by Beijin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for transgenically obtaining a nosomycosis resistant cut gerbera flower. The method obtains a transgenic plant through the following steps of: separating an antifungal gene, namely a chitinase gene Chi and a beta-1, 3-dextranase gene Glu, cloning the Chi and the Glu, constructing a bivalent expression vector, constructing a high-efficient genetic transformation regeneration system of the cut gerbera flower, transformation of the cut gerbera flower by the antifungal gene and so on. The method uses CaMV35S as starter and transforms genes like Chi, Glu, Npt II and so on into a cut gerbera flower variety 'redcap' and then obtains the transgenic plant, thereby providing technical support for obtaining a large number of antifungal transgenic African daisy strains. The method effectively provides the antifungal transgenic African daisy strains and simultaneously provides a quick, effective and stable technical path for African daisy genetic engineering breeding.

Description

technical field [0001] The invention relates to a technical method for disease-resistant breeding of important flower plants, in particular, two genes from different sources are integrated to genetically transform gerbera, which fundamentally solves the problem of serious fungal disease damage in areas where gerbera is mainly planted. The technology belongs to the field of biotechnology breeding. Background technique [0002] Gerbera (Gerbera jamesonii Bolus), also known as gerbera, is a perennial herbaceous flower of the genus Gerbera of the Chrysanthemum family of Compositae. It is one of the five famous fresh cut flowers in the world. It originated in the Transvaal region of South Africa. There are about 42 species of gerbera, which are mainly distributed in South Africa, Madagascar, India, China, Mongolia, Japan, South America and Australia. Because of their rich colors and beautiful shapes, they are loved by people all over the world. Today, gerbera is an important tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N15/82A01H1/00A01H5/00
Inventor 李涵晏慧君张婷李绅崇王继华张颢黎霞
Owner FLOWER RES INST OF YUNNAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com