Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cultivated silkworm glutathione-S-transferase BmGSTe5 gene

A technology of glutathione and transferase, applied in the direction of transferase, genetic engineering, plant genetic improvement, etc., can solve the problem that there is no pesticide resistance or antioxidant activity of silkworm.

Inactive Publication Date: 2008-03-12
SOUTHWEST UNIVERSITY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no research report on genes with anti-pesticide or anti-oxidative activity in silkworm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cultivated silkworm glutathione-S-transferase BmGSTe5 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0039]Search the Bombyx mori Expressed sequence tag (EST) database with the coding region sequence (Coding sequence, CDS) of the BmGSTe5 gene to find EST evidence for the BmGSTe5 gene, and then design gene-specific primers after splicing the CDS and EST sequences ; Forward primer of BmGSTe5: 5'TTCCGACTATGGTGTTCATCCTGTA 3', reverse primer: 5'TTGTATAATACCGGTTCAGCAGTGG 3'; using the designed specific primers to amplify the cDNA in the 5th instar 3 of the silkworm as a template, and obtain the target band, PCR After recovery, the product was ligated with the pMD18-T vector, transformed into DH5α competent cells, and sent to Shanghai Sangon for sequencing after obtaining positive clones. The sequencing results showed that the amplified sequence was consistent with the expected result; the target fragment was combined with pET28a, and T4 ligase Ligate and transform B121(DE3) competent cells, screen to obtain clones containing pET28a-BmGSTe7, and culture single clones containing pET28...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glutathione-S-transferase BmGSTe5 gene for silkworms, which is obtained by getting Epsilon homogenetic gene through retrieving in silkworm gene group by taking use of the known Epsilon family members of other species' GST and by cloning. The activity of the expression product over the mode background CDNB (1-Cl-2,4-dinitrobenzene) is 12 micro mol / min / mg protein. With this gene target, it is hopeful to design a medicine that can prevent and treat Lepidoptera destructive insects but is no harm to those useful insects. The invention is of high value for developing medicine and preventing and treating destructive insects.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a silkworm glutathione-S-transferase BmGSTe5 gene derived from silkworms with anti-pesticide or anti-oxidation activity. Background technique [0002] Pesticides play a very important role in pest control, but with the use of a large number of pesticides, insect resistance is increasing day by day, forcing people to develop new pesticide products or increase the dosage of pesticides, which not only restricts economic development, but also gives The environment has brought a serious burden, which affects the sustainable development of economy and human beings. In addition, insect resistance to pesticides is often associated with insect antioxidation. For example, during the process of detoxifying and metabolizing organophosphorus pesticides, insects may produce some active oxygen and other substances, thereby inducing the oxidative stress response of insects. At the same time as resi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10
Inventor 鲁成余泉友代方银潘敏慧向仲怀
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com