Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process

A technology for recombining antigenic proteins and antigenic proteins, applied in the fields of botanical equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of laborious, uneven mixing ratio, and time-consuming

Active Publication Date: 2008-02-13
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of multiple antigens in the research of diagnostic reagents requires the expression and purification of multiple antigens (or separate purification), which is not only time-consuming and laborious, but also has the problem of uneven mixing ratio, which may affect the sensitivity of diagnostic methods and specificity issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process
  • Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] [Example] Preparation of bovine tuberculosis diagnostic recombinant antigen protein of the present invention

[0041] PCR amplification of MPB70 gene: Mycobacterium bovis Vallee strain genomic DNA (China Institute for the Control of Biological Drugs) 1ul, primers MPB70-F and MPB70-R each 1ul (MPB70-F: AGGGTACCATGGAATACGCGGCAGCCAAT, SEQ ID NO: 5, MPB70-R : GGAACCTGGAGACGCCGGAGGCATTAG, SEQ ID NO: 6), primer concentration is 20pMol, 10×TagDNA polymerase Buffer5ul, 2.5mM dNTP3ul, pfu TagDNA polymerase 0.5ul, make up with water, reaction system is 50ul, then carry out PCR amplification. The amplified PCR product is 483bp. The conditions of the PCR reaction were: denaturation at 95°C for 5 minutes, denaturation at 94°C for 1 minute, annealing at 65°C for 1 minute, extension at 72°C for 1 minute, 30 cycles, and extension at 72°C for 10 minutes. Perform electrophoresis on 1.5% agar gel, and observe the results after 20 minutes at 100V. Then, the MPB70 gene was recovered using...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of recombinant antigen protein for diagnosing ox tuberculosis. The recombinant antigen protein is a fusion protein formed through connecting ox mycobacterium MPB70 antigen protein, MPB83 antigen protein and ESAT-6antigen protein successively, where, the MPB70 antigen protein possesses the amino acid sequence as shown in SEQ ID No. 1 of the sequence list, the MPB83 antigen protein possesses the amino acid sequence as shown in SEQ ID No. 2, and the ESAT-6antigen protein possesses the amino acid sequence as shown in SEQ ID No. 3. Experiment shows that the recombinant antigen protein has high sensitivity and specificity in diagnosing ox tuberculosis, so that it has wide application foreground.

Description

technical field [0001] The invention relates to a recombinant antigenic protein, in particular to a recombinant antigenic protein for diagnosing bovine tuberculosis and a preparation method thereof. Background technique [0002] Tuberculosis is an umbrella term for different diseases caused by the Mycobacterium tuberculosis complex, which includes M. tuberculosis human, M. bovis, M. africanum, and M. microti. Bovine tuberculosis is a zoonotic chronic wasting infectious disease caused by Mycobacterium bovis and Mycobacterium tuberculosis, which can be transmitted to humans or other animals through sick animals. Bovine tuberculosis occurs in all countries in the world, and it is still the most common multiple disease in my country. Bovine tuberculosis has many host spectrums and can infect almost all warm-blooded vertebrates. The epidemic of bovine tuberculosis not only seriously affects the sustainable and healthy development of animal husbandry, but also seriously threatens...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C07K14/35C12N15/31C12Q1/68G01N33/68
Inventor 刘思国郭设平王春来张秀华郭洋邵美丽
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com