Supercharge Your Innovation With Domain-Expert AI Agents!

Method for treating synovial sarcoma using sirna for fzd10

A molecular and expression vector technology, applied in the field of treatment and/or prevention of FZD10-related diseases in subjects, can solve the problems of unclear FZD10 cell function and implication, etc.

Inactive Publication Date: 2007-07-04
ONCOTHERAPY SCI INC
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although FZD10 expression has been demonstrated in primary colorectal cancer (Terasaki, H. et al., Int J Mol Med.9:107-12., 2002) and primary gastric cancer (Kirikoshi, H. et al., Int J Oncol 19:767-71., 2001) and upregulated in SS, but the cellular function and involvement of FZD10 in SS carcinogenesis remains unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for treating synovial sarcoma using sirna for fzd10
  • Method for treating synovial sarcoma using sirna for fzd10
  • Method for treating synovial sarcoma using sirna for fzd10

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Construction of siRNA expression vector

[0067] To study the cellular function of FZD10, we constructed a plasmid (psiU6BX-FZD10) expressing siRNA specific to FZD10 under the control of U6 promoter. Two siRNAs (psiU6BX-FZD10B and C) were constructed based on the FZD10ORF sequence.

[0068] (1) Construction of siRNA expression vector psiU6X3.0

[0069] Because the snRNA U6 gene is reported to be transcribed by RNA polymerase III, which produces short transcripts with uridine at the 3' end, we amplified the genome of the snRNA U6 gene containing its promoter region by PCR Fragment, the PCR utilized a set of primers 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No. 11) and 5'-TAGGCCC CACCTCCTTCTAT-3' (SEQ ID No. 12) and human placental DNA as templates. The product was purified and cloned into the pCR plasmid vector using the TA cloning kit according to the manufacturer's protocol (Invitrogen). The BamHI, XhoI digested fragment containing the snRNA U6 gene was purified and cloned...

Embodiment 2

[0101] Effect of FZD10-siRNA on the growth of synovial sarcoma cell line

[0102] We transfected the plasmid prepared in Example 1 into the synovial sarcoma cell line SYO-1 and checked the expression level of FZD10 by semi-quantitative RT-PCR. Likewise, we performed cell growth assays to confirm cell growth inhibition.

[0103] (1) Semi-quantitative RT-PCR

[0104] SYO-1 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Using the cell line Nucleofector TM Kit V (Amaxa Biosystems, Cologne, Germany) was used to transfect SYO-1 cells. Transfected cells were assayed 48-72 hours after transfection.

[0105] Total RNA was extracted from transfected cells using TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. The extracted RNA was treated with DNase I (Roche Diagnostics, Mannheim, Germany) and oligo(dT) 12-18Primers were reverse transcribed into single-stranded cDNA using Superscript II rev...

Embodiment 3

[0115] Formation of FZD10 homodimers

[0116] Since FZD1, a member of the Frizzled family, has been reported to form oligomers (Kaykas A, et al. (2004). Nat. Cell Biol. 6:52-8), we investigated whether FZD10 is also capable of oligomerization by immunoprecipitation. Two FZD10 constructs, HA-FLAG-FZD10 (described below) and FZD10-myc-His (prepared in Example 1; Figure 2A), were co-transfected into COS-7 cells and co-transfected using α-HA antibody. Immunoprecipitation.

[0117] For the construction of HA-FLAG-FZD10, the following set of oligonucleotides, 5'-ACGT GTC GAC TACCCATACGACGTCCCAGACTACGCTATGGACTACAAGGACGACGATGACAAGCTCGAGATGC-3' (SEQ ID No.37) (the underline indicates the SalI site) and 5'-GCAT CTCGAG CTTGTCATCGTCGTCCTTGTAGTCCATAGCGTAGTCTGGGACGTCGTATGGGTAGTCGACACGT-3' (SEQ ID NO. 38) (XhoI site underlined) was annealed and digested with SalI and XhoI to generate the HA-FLAG tag. First, residues 1-217 and 218-stop codon (or C-terminal deletion) fragments were PCR am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for inhibiting or reducing an expression of FZD10 gene is provided. Also, a method for treating and / or preventing FZD10-associated disease in a subject is provided. Further provided is a pharmaceutical composition comprising an double-stranded RNA molecule for FZD10 or an expression vector capable of expressing a double-stranded RNA molecule for FZD10.

Description

[0001] Cross References to Related Applications [0002] This application claims priority to US Provisional Application 60 / 598,834, filed August 5,2004. The entire content of the aforementioned application is hereby incorporated by reference in its entirety. field of invention [0003] The present invention relates to methods for inhibiting or reducing the expression of the FZD10 gene. Likewise, the present invention relates to methods of treating and / or preventing FZD10-associated diseases, in particular synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia and acute myeloid leukemia, in a subject. Furthermore, the present invention relates to a pharmaceutical composition comprising a double-stranded RNA molecule against FZD10 or an expression vector capable of expressing a double-stranded RNA molecule against FZD10. Background of the invention [0004] Frizzled homologue 10 (FZD10) is a member of the frizzled family, which are receptors for Wnt si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11A61K31/713A61P35/00C12N15/113
CPCC12N15/1138C12N2310/111C12N2310/14C12N2310/53A61P1/04A61P35/00A61P35/02
Inventor 中村祐辅片桐丰雅福川千香子
Owner ONCOTHERAPY SCI INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More