Design and fermented production of recombinant peptide for reducing blood pressure
A technology of antihypertensive peptide and fermentation method, which is applied in the direction of fermentation, recombinant DNA technology, peptide, etc., and can solve the problems of high production cost and difficult implementation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] 1. Gene design and synthesis: According to animal experiments or human food effects, small peptides that do have antihypertensive effects and are derived from human food are collected to form a small peptide library (specific peptide library). Select one or more of them to form a fusion protein, and convert the amino acid sequence of the fusion protein into the nucleotide sequence of the coding gene according to the Escherichia coli preference code. The gene was fully synthesized by chemical synthesis.
[0016] GAATCCCGCGGCCACAAAATCGCGACCTTTCAGGAACGCCTGTATCCGG
[0017] TGCGCGCGGTGAACCCGATTCGCGCGGTGCCGTATCCGCAGCGCCTGC
[0018] GCCCGTAAAAGCTT
[0019] 2. Construct the expression vector and obtain the engineering bacteria: select the commercialized plasmid pET-28a(+) of Novagen Company as the carrier, carry out double enzyme digestion (Eco R I+Hind III) of the target gene and the carrier DNA, and then connect them with T4DNA ligase , The product of the ligation reaction...
Embodiment 2
[0026] The small peptide produced by fermentation of the present invention is used in the antihypertensive test, and the result is the same as the antihypertensive peptide obtained from natural sources.
[0027] The test method for antihypertensive peptides to inhibit ACE I activity is quoted from: "Functional Fermented Products" edited by You Xin, p: 220-221, China Light Industry Press, 2000.1, first edition.
[0028] Preface
[0029] Preface
[0030] Note: IC 50 (μmol / L) refers to the concentration of antihypertensive peptide required when ACE I activity is inhibited to half. The smaller the value, the stronger the pressure reducing effect.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com