Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Development and application of decaploid agropyron elongatum molecular marker and tandem repeat probe thereof

A technology of wheat grass and molecular marker, which is applied in the biological field and can solve problems such as Oligo probes that have not yet been seen

Pending Publication Date: 2022-04-19
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there have been reports on the development of repeat probes for E. elongatum, there has been no report on the development of Oligo probes using the tandem repeats of E. elongatum.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Development and application of decaploid agropyron elongatum molecular marker and tandem repeat probe thereof
  • Development and application of decaploid agropyron elongatum molecular marker and tandem repeat probe thereof
  • Development and application of decaploid agropyron elongatum molecular marker and tandem repeat probe thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1、 10

[0036] Example 1. Development of molecular markers and probes for decaploid Echinopsis elongatum

[0037] 1. Development of specific molecular markers for exogenous fragments of translocation line DT80

[0038] The inventors discovered a specific molecular marker of an exogenous fragment of DT80, which is denoted as pThp80.1, and its sequence (5'-3') is as follows:

[0039] GTACGGTCCGGAATTTCGTTTCCCGCCCAAAGTTTCGTCTCCCGCTTGAAATACAGTCTCGCGCCCGTTTCTCAA ATTTGGATCCCTCCATTTTGTATTTTTTTGGTATATTATTTTTTTGTGTCGGGGAGAGGCCGTGGCAATGGTGAACAATATAGCACACCCAAATTTGGCATGACGGCGAAATTTTCCCGCCAAAATCACGAAAAGTGACCACGTGTCCGTCGTCGTCGTCGTCGAAAATCGTGTCCGTGTCCGTCGAAATCGTGTCG

[0040] The molecular marker can be amplified by primer pair MWTT80-1 (composed of single-stranded DNA named MWTT80-1F and MWTT80-1R respectively), and the sequences (5'-3') of MWTT80-1F and MWTT80-1R are as follows:

[0041] MWTT80-1F: GTACGGTCCGGAATTTCGTT (sequence 2 in the sequence listing);

[0042] MWTT80-1R: GGGAGCGATTTGAGACACTC ...

Embodiment 2

[0070] Example 2. Distinguishing the 6 exogenous chromosomes of octoploid Tritium tritium 7430 by using the repetitive sequence probe pThp80.1

[0071] Xiaoyan 7430 (Zheng et al. 2014, 2015; Li et al. 2016) is an octoploid Tritititum obtained from the distant hybridization of Thipotinia elongatum and common wheat from the former Northwest Institute of Botany, Chinese Academy of Sciences. Molecular and cytological identification showed that it had 44 wheat chromosomes and 12 E. elongatum chromosomes. Disease resistance surveys found that it has good resistance to stem rust, stripe rust and powdery mildew. The inventor's research group used chromosome engineering to create the tritulinum isoaddition line Xiaoyan85 and the translocation line Xiaoyan447, which were derived from Xiaoyan 7430 and were highly resistant to Ug99 (Li et al.2016). Subsequently, Xiaoyan85 was irradiated with pollen, and the small fragment translocation lines Xiaoyan851, Xiaoyan852 and Xiaoyan853 were fur...

Embodiment 3

[0074] Example 3. Identification of Exogenous Chromosomal Segments in the Background of Wheat Using E. elongatum Specific Oligonucleotide Probe Oligo-pThp80.1-2

[0075] Translocation line DT80 mitotic metaphase cells were prepared, and Oligo-pThp80.1-2 in Step 3 of Example 1 was used as a probe for ND-FISH analysis. The experimental steps were the same as Step 3 of Example 1.

[0076] The results showed that there were punctate signals on the exogenous chromosome segment of the translocation line DT80, indicating that the Oligo-pThp80.1-2 probe could be used to trace the exogenous chromosome segment of the translocation line DT80 ( image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 10-ploid agropyron elongatum molecular marker and development and application of a tandem repeat probe of the 10-ploid agropyron elongatum molecular marker. The elytrigia elongata molecular marker disclosed by the invention is a DNA molecule as shown in a sequence 1 in a sequence table, the sequence of a probe of the elytrigia elongata molecular marker is the sequence 1, the sequence 4, the sequence 5, the sequence 6 or the sequence 7 in the sequence table, and the elytrigia elongata molecular marker is provided with a fluorophore or a fluorescent dye. According to the invention, by virtue of a specific site amplified fragment sequencing (SLAF-seq) method, the thinopyrum elongatum specific molecular marker and a tandem repeat sequence probe are developed, so that the thinopyrum elongatum specific oligonucleotide (Oligo) probe is further obtained, and the probe lays a foundation for efficiently identifying the thinopyrum elongatum chromosome fragment under the wheat background.

Description

technical field [0001] The invention relates to the development and application of a decaploid E. elongatum molecular marker and a tandem repeat probe thereof in the field of biotechnology. Background technique [0002] Wheat (Triticum aestivum L.) is one of the three most important food crops in the world. According to incomplete statistics, the global wheat planting area accounts for 17.0% of the global grain planting area (217 million hectares) (FAO, 2012). In 2019, my country's wheat planting area was 23,700 hectares, accounting for 20.41% of the total annual grain sowing area (116,100 hectares) (http: / / www.stats.gov.cn / ). According to the forecast of relevant experts, the total global population will exceed 10 billion by 2050, and the wheat yield per unit area needs to increase by 70% to meet the demand brought about by population growth (Tilman et al.2002; Foley et al.2011). Therefore, the development and application of new wheat breeding technologies are particularl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6841C12Q1/6869C12N15/11
CPCC12Q1/6895C12Q1/6841C12Q1/6869C12Q2563/107C12Q2525/151C12Q2535/122C12Q2531/113
Inventor 郑琪杨国堂佟春艳李宏伟李滨李振声
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More