Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Photocleavable protein mutants with high photocleavage efficiency and applications thereof

A protein mutant and light cutting technology, applied in the field of genetic engineering, can solve the problems of long UV light irradiation time and low cutting efficiency, and achieve the effect of improving light cutting efficiency, purification efficiency and high light cutting efficiency.

Active Publication Date: 2022-06-03
COFCO NUTRITION & HEALTH RES INST
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a photocleavable protein mutant with high photocleavage efficiency and its application in order to overcome the problems of long UV light irradiation time and low cutting efficiency when the photocleavable protein is photocleaved in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Photocleavable protein mutants with high photocleavage efficiency and applications thereof
  • Photocleavable protein mutants with high photocleavage efficiency and applications thereof
  • Photocleavable protein mutants with high photocleavage efficiency and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used to illustrate the obtaining of the photocleavable protein provided by the present invention.

[0063] The pBAD-phoCl plasmid used in this example is a pBAD plasmid as a carrier, and is inserted into the expression system of the phoCl expression gene. The preparation method can refer to Zhang Fan, 2012, Preparation of recombinant Bifidobacterium longum engineering bacteria expressing interferon-α2b, China Journal of Pathogen Biology, 007(003):190-191,194.

[0064] In the present example, primers F1 (ATGGTGATCCCTGACTACTTCAAGCAG, SEQ ID NO: 11) and R1 (TTACCGTGGGTACTTGGTGAACACG, SEQ ID NO: 12) were both synthesized by Entrust Ruibo Xingke Biotechnology Co., Ltd.

[0065] (1) Construction of a library of photocleavable protein mutants

[0066] Using the pBAD-phoCl plasmid as the template and primers F1 and R1 as the forward and reverse primers, the directional evolution of error-prone PCR was performed according to the reaction system in Table 1 and the ...

Embodiment 2

[0097] This example is used to illustrate the expression and purification of the fusion protein provided by the present invention.

[0098] (1) Detection of fusion protein activity

[0099] Based on molecular biology operations, the mutant proteins 1 and 2 screened in test (5) in Example 1 were fused and expressed with the antimicrobial peptide Hisatatin 1.

[0100] The original protein phoCl, mutant 1 and mutant 2 linked with a purification tag (polyhistidine tag, the amino acid sequence is shown in SEQ ID NO: 4) were respectively fused and expressed with the antimicrobial peptide Hisstatin1 (commissioned by General Biotechnology). , after purification by the purification tag, the purified protein was cleaved at 385nm wavelength for 0min, 1min, 5min, 10min, 30min, 60min, 90min and 120min, and the cleavage was detected by electrophoresis.

[0101] Figure 12-14 The antimicrobial peptide expressed in fusion with the original protein (phoCl-Histatin1), the antimicrobial peptid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of genetic engineering, and discloses a photocleavable protein mutant with high photocleavage efficiency and application thereof. The photocleavable protein mutant is a mutant of the photocleavable protein phoCl, the amino acid sequence of the photocleavable protein phoCl is shown in SEQ ID NO: 1, and the photocleavable protein mutant is in the photocleavable protein At least one of amino acid residues 8-232 of phoCl has a mutation. The light-cleavable protein mutant provided by the present invention can achieve higher cutting efficiency in a shorter UV irradiation time. The photocleavable protein mutant provided by the present invention can be fused and expressed with different target proteins, the obtained fusion protein has high purification efficiency, and the efficient recovery of the target protein can be realized.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a photo-cleavable protein mutant with high photo-cleavage efficiency and an application thereof. Background technique [0002] With the development of biotechnology, relatively mature and efficient prokaryotic and eukaryotic cell-like protein expression systems have been developed, and the use of microbial expression systems for target protein production has gradually formed a large-scale industrial production system. However, the expression of the target protein is often accompanied by the expression of other proteins in the expression system, so that the obtained expression products are often a mixture of the target protein and other proteins. Therefore, protein purification has become a key link in genetic engineering and protein engineering. The efficiency of protein purification determines the yield of recombinant protein, and protein purification technology also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/00C07K19/00
Inventor 周娜娜安泰王小艳王磊张媛赵国淼王靖李凡杨凯王满意牛兴和郝小明
Owner COFCO NUTRITION & HEALTH RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com