Supercharge Your Innovation With Domain-Expert AI Agents!

A molecular marker detection kit, nucleic acid combination and application of primary liver cancer

A primary liver cancer, molecular marker technology, applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of low sensitivity and accuracy, and few blood markers for hepatocellular carcinoma and other problems, to achieve the effect of reducing morbidity and mortality, increasing the proportion of early diagnosis, and high accuracy of early screening

Active Publication Date: 2022-02-18
苏州艾米森生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are few blood markers for hepatocellular carcinoma reported so far, and the sensitivity and accuracy are not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker detection kit, nucleic acid combination and application of primary liver cancer
  • A molecular marker detection kit, nucleic acid combination and application of primary liver cancer
  • A molecular marker detection kit, nucleic acid combination and application of primary liver cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 1.

[0052] Nucleic acid combination 1 includes primer combination 1 and probe 1, primer combination 1 includes nucleotides shown in SEQ ID NO.7-8, and the base sequence of probe 1 is shown in SEQ ID NO.9. This nucleic acid combination 1 can detect the methylation level of the Chr2:25216048-25216151 region positive strand (target region 1).

[0053] The upstream primer sequence for region 1 methylation-specific PCR is (5’-3’):

[0054] GTTATTTCGGCGAGTAGAGTCG (SEQ ID NO. 7);

[0055] The downstream primer sequences for region 1 methylation-specific PCR are (5'-3'):

[0056] AACTACCCGCGAAAACTTCCG (SEQ ID NO. 8);

[0057] The sequence of probe 1 for region 1 methylation-specific PCR is (5’-3’):

[0058] TCGGTGCGTTGGTTTCGTTCG (SEQ ID NO. 9).

Embodiment 2

[0060] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 2.

[0061] Nucleic acid combination 2 includes primer combination 2 and probe 2, primer combination 2 includes nucleotides shown in SEQ ID NO.10-11, and the base sequence of probe 2 is shown in SEQ ID NO.12. This nucleic acid combination 2 can detect the methylation level of Chr2: 25216146-25216277 region positive strand (target region 2).

[0062] The upstream primer sequence of region 2 methylation-specific PCR is (5'-3'): GTAGTTGGGGAGGAAATCGC (SEQID NO.10);

[0063] The downstream primer sequences for region 2 methylation-specific PCR are (5'-3'):

[0064] AACACTCCGACTAACGACGC (SEQ ID NO. 11);

[0065] The sequence of probe 2 for region 2 methylation-specific PCR is (5’-3’):

[0066] TTCGGTTCGGGAAGGGTAGTGC (SEQ ID NO. 12).

Embodiment 3

[0068] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 3.

[0069] Nucleic acid combination 3 includes primer combination 3 and probe 3, primer combination 3 includes nucleotides shown in SEQ ID NO.13-14, and the base sequence of probe 3 is shown in SEQ ID NO.15. This nucleic acid combination 3 can detect the methylation level of Chr2: 25216265-25216351 region positive strand (target region 3).

[0070] The upstream primer sequence of region 3 methylation-specific PCR is (5'-3'): TAGTCGGAGTGTTCGGCGTTC (SEQ ID NO.13);

[0071] The downstream primer sequences for region 3 methylation-specific PCR are (5'-3'):

[0072] ACTACGAACTAAAACTCCGCAACGT (SEQ ID NO. 14);

[0073] The sequence of probe 3 for region 3 methylation-specific PCR is (5'-3'):

[0074] TTTTTGCGTCGGTTTAGGATTCGTA (SEQ ID NO. 15).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a primary liver cancer molecular marker detection kit, nucleic acid combination and application, and relates to the technical field of liver cancer diagnosis. The present invention can identify whether the target sample is primary liver cancer by detecting the methylation level of the CpG site in the Chr2:25216044-25216394 region and its reverse complementary sequence. The methylation of the CpG site in the above region has good sensitivity and specificity for the detection or diagnosis of primary liver cancer, and can be used to distinguish liver cancer samples from healthy samples, and liver cancer samples from liver cirrhosis samples. The invention provides good molecular markers for early screening of liver cancer, and has the advantages of high early screening accuracy, non-invasive, convenient, safe, fast and high throughput. The molecular markers provided by the invention are expected to increase the proportion of early diagnosis of high-risk groups of hepatocellular carcinoma in my country, realize early detection and early treatment, and reduce the incidence and mortality of hepatocellular carcinoma.

Description

technical field [0001] The invention relates to the technical field of liver cancer diagnosis, in particular to a molecular marker detection kit, nucleic acid combination and application of primary liver cancer. Background technique [0002] Primary liver cancer is the fourth common malignant tumor and the second leading cause of cancer death in my country. Primary liver cancer mainly includes three different pathological types: hepatocellular carcinoma, intrahepatic cholangiocarcinoma, and mixed hepatocellular carcinoma-intrahepatic cholangiocarcinoma, among which hepatocellular carcinoma accounts for 85% to 90%. Hepatitis C virus (HBV / HCV) infection, non-alcoholic fatty liver disease caused by obesity, chronic alcohol abuse, etc. These factors may directly lead to the development of liver cirrhosis, and the annual incidence of liver cancer in patients with liver cirrhosis is 2%-4% . [0003] At present, the guidelines recommended by the guidelines for the diagnosis and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/154C12Q2600/166
Inventor 张玮李国强
Owner 苏州艾米森生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More