Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene therapy DNA vector

A technology of gene therapy and carrier, applied in the field of genetic engineering, can solve problems such as limited further implementation

Pending Publication Date: 2021-10-12
CELL & GENE THERAPY LTD +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0031] However, the limitations of the use of plasmid vectors in gene therapy are: 1) the presence of antibiotic resistance genes for the production of constructs in bacterial strains; 2) the presence of various regulatory elements represented by viral genome sequences; 3 ) The length of the therapeutic plasmid vector that determines the efficiency of vector delivery to target cells
Disadvantages of the invention include limited further implementation of the invention in the treatment of neurological disorders, and the use of genetically modified cells to increase VIP and CGRP expression, but not DNA vectors expressing these genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene therapy DNA vector
  • Gene therapy DNA vector
  • Gene therapy DNA vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0228] Generation of gene therapy DNA vector VTvaf17-NOS2 carrying a therapeutic gene (ie NOS2 gene).

[0229] The gene therapy DNA vector VTvaf17-NOS2 was constructed by cloning the coding region (3466bp) of the NOS2 gene into the 3165bp DNA vector VTvaf17 by SalI and KpnI restriction sites. By isolating total RNA from biological human tissue samples, followed by a reverse transcription reaction using the commercial kit Mint-2 (Evrogen, Russia), and using the following oligonucleotides as well as commercially available kits High-fidelity DNA polymerase (New England Biolabs, USA) for PCR amplification

[0230] To obtain the coding region (3466bp) of the NOS2 gene:

[0231] NOS2_F ATCGTCGACCACCATGGCCTGTCCTTGGAAATTTC,

[0232] NOS2_R CGGTACCTCCAGAGCGCTGACATCTCCAGG.

[0233] The gene therapy DNA vector VTvaf17 was constructed by integrating six fragments of DNA derived from different sources:

[0234] (a) The origin of replication was generated by PCR amplification of a regi...

Embodiment 2

[0244] Generation of gene therapy DNA vector VTvaf17-NOS3 carrying a therapeutic gene (ie NOS3 gene).

[0245] The gene therapy DNA vector VTvaf17-NOS3 was constructed by cloning the coding region (3615bp) of the NOS3 gene into the 3165bp DNA vector VTvaf17 by HindIIII and EcoRI restriction sites. By isolating total RNA from biological human tissue samples, followed by a reverse transcription reaction using the commercial kit Mint-2 (Evrogen, Russia), and using the following oligonucleotides as well as commercially available kits High-fidelity DNA polymerase (New England Biolabs, USA) was used for PCR amplification to obtain the coding region (3615bp) of the NOS3 gene:

[0246] NOS3_F GACAAGCTTCCACCATGGGCAACTTGAAGAG,

[0247] NOS3_R GGAATTCAGGGGCTGTTGGTGTCTGAGCCG; the amplified product and the DNA vector VTvaf17 were cut by restriction endonucleases HindIIII and EcoRI (New England Biolabs, USA).

[0248] This formed a 6774 bp DNA vector VTvaf17-NOS3 having the nucleotide se...

Embodiment 3

[0251] Generation of gene therapy DNA vector VTvaf17-VIP carrying a therapeutic gene (i.e. human VIP gene).

[0252] The gene therapy DNA vector VTvaf17-VIP was constructed by cloning the coding region (511bp) of the VIP gene into the 3165bp DNA vector VTvaf17 by BamHI and EcoRI restriction sites. By isolating total RNA from biological human tissue samples, followed by a reverse transcription reaction using the commercial kit Mint-2 (Evrogen, Russia), and using the following oligonucleotides as well as commercially available kits High-fidelity DNA polymerase (New England Biolabs, USA) was amplified by PCR to obtain the coding region (511bp) of the VIP gene:

[0253] VIP_F AGGATCCACCATGGACACCAGAAATAAGGCCCAG,

[0254] VIP_R GGAATTCATTTTTTCTAACTTCTTCTGGAAAG; the amplified product and the DNA vector VTvaf17 were cut by restriction endonucleases BamHI and EcoRI (New England Biolabs, USA).

[0255] This forms a 3652 bp DNA vector VTvaf17-VIP having the nucleotide sequence of SEQ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention refers to genetic engineering and can be used in biotechnology, medicine, and agriculture for the manufacture of gene therapy products. Gene therapy DNA vector based on the gene therapy DNA vector VTvaflV carrying the therapeutic gene selected from the group of NOS2, NOS3, VIP, KCNMA1, and CGRP genes is constructed in order to increase the expression level of this therapeutic gene in humans and animals, while gene therapy DNA vector VTvafl7-NOS2, or VTvaflV- NOS3, or VTvafl7-VIP, or VTvafl7-KCNMAl, or VTvafl7-CGRP has the nucleotide sequence SEQ ID No. 1, or SEQ ID No. 2, or SEQ ID No. 3, or SEQ ID No. 4, or SEQ ID No. 5, respectively. Each of the constructed gene therapy DNA vectors, namely VTvafl7-NOS2, or VTvafl7-NOS3, or VTvafl7-VIP, or VTvafl7-KCNMAl, or VTvafl7-CGRP has the ability to efficiently penetrate into cells and express the therapeutic gene selected from the group of NOS2, NOS3, VIP, KCNMA1, and CGRP genes, respectively, and cloned to it due to the limited size of VTvafl7 vector part not exceeding 3200 bp. The gene therapy DNA vector contains no nucleotide sequences of viral origin and no antibiotic resistance genes, which ensures its safe use for gene therapy in humans and animals.

Description

technical field [0001] The present invention relates to genetic engineering and can be used in biotechnology, medicine and agriculture for the manufacture of gene therapy products. Background technique [0002] Gene therapy is an innovative approach in medicine aimed at treating inherited and acquired diseases by delivering new genetic material into a patient's cells to compensate or suppress the function of mutated genes and / or treat genetic disorders. The end products of gene expression can be RNA molecules or protein molecules. However, most physiological processes in the body are related to the functional activity of protein molecules, while RNA molecules are either intermediate products of protein synthesis or perform regulatory functions. Thus, in most cases, the goal of gene therapy is to infuse organisms with genes that provide for the transcription and further translation of the protein molecules encoded by these genes. In the description of the present invention,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/70C12N1/21A61K48/00C12R1/19
CPCC12N15/70C12N15/85A61K48/0016C12N9/0075C12Y114/13039A61K48/005
Inventor N.萨韦利瓦
Owner CELL & GENE THERAPY LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com