Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids

A technology of cytochrome and Ganoderma lucidum triterpenes, applied in the direction of steroids, applications, and microbial-based methods, which can solve the problems of slow growth of the host

Active Publication Date: 2021-09-28
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Aiming at the shortcomings of the existing artificial cultivation of Ganoderma lucidum or the slow growth of the host of Ganoderma lucidum submerged fermentation, the present invention proposes a strategy based on synthetic biology to discover novel Ganoderma lucidum triterpenoids and The method of realizing its heterologous biosynthesis, specifically, is to realize the heterologous synthesis of Ganoderma triterpenoids by excavating and identifying the cytochrome P450 enzyme gene related to the biosynthesis of Ganoderma lucidum triterpenoids, and heterologously expressing them in Saccharomyces cerevisiae cells Biosynthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids
  • Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids
  • Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0107] Construction of Saccharomyces cerevisiae strain overexpressing ganoderma acid HLDOA

[0108] The yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr was transformed into Saccharomyces cerevisiae YL-T3 to form Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR after recombinant transformation. The specific operation steps are as follows:

[0109] Construction of Yeast Expression Plasmid pRS425-CYP5150L8-iGLCPR-Hygr

[0110] 1.1) Transformation is carried out on the basis of pRS425-iGLCPR-Hygr. The pRS425-iGLCPR-Hygr plasmid can be obtained by referring to (Lan, Yuan, Wang, & Xiao, 2019). First, the plasmid pRS425-iGLCPR-Hygr was digested with Pmel enzyme to obtain a linearized plasmid vector fragment.

[0111] 1.2) Then use the primer pair HF-CYP5150L8-F and HF-CYP5150L8-R, with pRS426-HXT7p-CYP5150L8-FBA1t (Lan, X., et al., Biotechnol Bioeng, 2019.116(12):3301-3311) as a template The CYP5150L8de expression cassette containing homology arms was amplified. The specific ...

Embodiment 2

[0127] Construction of Saccharomyces cerevisiae Transformation Strains Expressing CYP Genes

[0128] 2.1) Using Ganoderma lucidum cDNA as a template, the sequence fragments of the CYP gene coding region were obtained by PCR amplification, and the coding region sequence fragments of GL20421 and GL21117 were SEQ ID No.1 and SEQ ID No.3, respectively. The primer sequences used to amplify and obtain the sequence fragments of the coding regions of the CYP genes GL20421 and GL21117 of Ganoderma lucidum from the cDNA of Ganoderma lucidum are shown in Table 3.

[0129] Table 3. List of primer sequences used to amplify Ganoderma lucidum CYP gene coding region sequence fragments

[0130] Primer name serial number Sequence(5'to 3') GL20421-F SEQ ID No.9 taattttaatcaaaaagtttatgatcatcccagtagacat GL20421-R SEQ ID No.10 attaatttgaattaacgttttcagtctgcacgacgcaccc GL21117-F SEQ ID No.11 taattttaatcaaaaagtttatggcgacgttggaggaccc GL21117-R SEQ ID No.1...

Embodiment 3

[0143] Example 3 Determination of CYP genes and functional identification by fermentation of yeast transformants

[0144] Fermentation of yeast transformed strains:

[0145] 3.1) The constructed transformants of yeast transformation strains containing CYP genes (GL20421 gene or GL21117 gene) were fermented, and an empty plasmid strain without CYP gene was used as a control. By comparing the differences of metabolites after fermentation, the CYP genes that may be related to the biosynthesis of Ganoderma lucidum triterpenes were preliminarily screened. The specific operation is as follows:

[0146]3.1.1) Transformants of the transformed yeast strains comprising CYP genes constructed in Example 2 were liquid-transferred into 3 mL of SC-His-Leu-Ura (SC-HLU) liquid medium (yeast nitrogen base without amino acids (YNB), 6.7g / L; glucose, 20g / L; yeast synthetic drop-out media (SD) Y2001, 1.39g / L; tryptophan, 76mg / L), placed in Qualcomm Cultivate in a shaker for 24 hours;

[0147] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids. The CYP gene GL20421 obtained by the invention can catalyze ganoderic acid HLDOA to form a new natural ganoderma lucidum triterpenoid product, namely the ganoderma lucidum triterpenoids shown as a formula (I); and the obtained CYP gene GL21117 can catalyze ganoderic acid Jb formed by ganoderic acid HLDOA, and the ganoderic acid Jb is completely consistent with a natural compound structure and has the same product performance and quality. The GL20421 gene and the GL21117 gene are subjected to heterologous expression in saccharomyces cerevisiae, heterologous biosynthesis of the ganoderma lucidum triterpenoids is achieved, the yield is high, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to cytochrome P450 enzyme and its application in synthesizing ganoderma triterpenoids. Background technique [0002] Triterpenoids are composed of six isoprene units, widely distributed in nature, and there are many kinds, mainly in the form of free, glycoside or ester, widely present in ferns, fungi, monocotyledon and dicotyledonous plants , and a few exist in animals (Vincken, J.P., et al., Phytochemistry, 2007.68(3): p.275-97). Studies have shown that triterpenoids have various biological activities such as hypoglycemic, anti-inflammatory, and hypolipidemic (Zheng Guanghai et al., West China Pharmaceutical Journal, 2011.26 (03): 294-297), and are important lead compounds for antidiabetic drug research (the Kui Niu et al., Journal of China Pharmaceutical University, 2015, 46(6): 764-770), has the characteristics of "targeted killing" in anti-tumor, and is effective agains...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/02C12N1/21C12N1/19C12P33/00C07J9/00C12R1/865C12R1/84C12R1/19
CPCC12N9/0081C12P33/00C12Y114/15006C07J9/005
Inventor 王猛肖晗袁伟
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com