A dna molecular weight standard fragment amplification single-stranded primer, amplification method and preparation method of dna molecular weight standard
A molecular weight standard, single-stranded technology, used in the preparation of DNA molecular weight standards, the field of DNA molecular weight standard amplification fragment single-stranded primers, can solve the problems of unfavorable purification, large-scale production, residual template, high cost, and avoid non-specificity. The effect of banding, improving efficiency, and reducing amplification cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0041] The preparation method of the DNA molecular weight standard provided by the present invention, the DNA molecular weight standard includes a DNA fragment with a length of 100bp, and the DNA fragment is obtained by the above-mentioned amplification method; after the DNA fragment of 100bp is obtained, it is mixed with DNA fragments of other lengths, Get the DNA marker.
[0042] Preferably, the DL2000 DNA marker can be prepared by the preparation method of the present invention.
Embodiment
[0044] In this embodiment, a single-stranded primer with a length of 60 bp is used for amplification, and its 3' end has a palindromic sequence of 20 bp.
[0045] The single-stranded primer sequence in this embodiment is shown in SEQ ID No: 1, specifically:
[0046] 5`-TCCGATCGAATTCAATTAGAATTCAGCTAGAATTCATTCAGAATTCGCGGCCGCGAATTC-3`;
[0047]Wherein, the palindrome sequence is GAATTCGCGGCCGCGAATTC(-3'), and the GC content is 50%.
[0048] Using the above single-stranded primers for PCR amplification, the reaction system is:
[0049] 45 μl gold medal PCR mix, 5 μl primers; reaction program: 98°C for 90s, 98°C for 10s, 58°C for 10s, 72°C for 10s, 72°C for 1min, 4°C hold, 35 cycles.
[0050] In the above cycle process, the specific replication process of the primer is:
[0051] The first round of amplification is carried out first, and the specific process is as follows: figure 1 As shown, one single-stranded primer molecule and another single-stranded primer molecule are anne...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com