Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA molecular weight standard fragment amplification single-chain primer, amplification method and DNA molecular weight standard preparation method

A molecular weight standard, single-stranded technology, which is used in the preparation of DNA molecular weight standards and single-stranded primers for DNA molecular weight standard amplification fragments, can solve the problems of high cost, residual template, unfavorable purification, large-scale production, etc., to improve efficiency , reduce the cost of amplification, avoid the effect of non-specific bands

Active Publication Date: 2021-08-13
北京擎科生物科技股份有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows for simultaneously developing two different types of probes: one with specific sequences that are designed specifically towards target nucleic acids while another probe has no or very few ones at all (smallest pieces). By doing this, these techniques reduce the amount of time needed when multiple steps must occur before they work together on an assay. Additionally, there may exist other methods like enzyme digestion or chemical modification to make them more effective than others. Overall, this new technique simplifies the overall manufacturing processes and saves money compared to traditional methods such as polymerase chain reaction (PCR), making it better suited for applications where low amounts of sample material have been collected from samples containing unknown substances.

Problems solved by technology

This patented technical problem addressed by this patent relates to finding ways to efficiently prepare smaller DNA samples that can accurately measure certain properties like size without requiring expensive equipment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA molecular weight standard fragment amplification single-chain primer, amplification method and DNA molecular weight standard preparation method
  • DNA molecular weight standard fragment amplification single-chain primer, amplification method and DNA molecular weight standard preparation method
  • DNA molecular weight standard fragment amplification single-chain primer, amplification method and DNA molecular weight standard preparation method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0041] The preparation method of the DNA molecular weight standard provided by the present invention, the DNA molecular weight standard includes a DNA fragment with a length of 100bp, and the DNA fragment is obtained by the above-mentioned amplification method; after the DNA fragment of 100bp is obtained, it is mixed with DNA fragments of other lengths, Get the DNA marker.

[0042] Preferably, the DL2000 DNA marker can be prepared by the preparation method of the present invention.

Embodiment

[0044] In this embodiment, a single-stranded primer with a length of 60 bp is used for amplification, and its 3' end has a palindromic sequence of 20 bp.

[0045] The single-stranded primer sequence in this embodiment is shown in SEQ ID No: 1, specifically:

[0046] 5`-TCCGATCGAATTCAATTAGAATTCAGCTAGAATTCATTCAGAATTCGCGGCCGCGAATTC-3`;

[0047]Wherein, the palindrome sequence is GAATTCGCGGCCGCGAATTC(-3'), and the GC content is 50%.

[0048] Using the above single-stranded primers for PCR amplification, the reaction system is:

[0049] 45 μl gold medal PCR mix, 5 μl primers; reaction program: 98°C for 90s, 98°C for 10s, 58°C for 10s, 72°C for 10s, 72°C for 1min, 4°C hold, 35 cycles.

[0050] In the above cycle process, the specific replication process of the primer is:

[0051] The first round of amplification is carried out first, and the specific process is as follows: figure 1 As shown, one single-stranded primer molecule and another single-stranded primer molecule are anne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a DNA molecular weight standard fragment amplification single-chain primer, an amplification method and a preparation method of the DNA molecular weight standard. The 3' end of the single-chain primer is provided with a palindromic sequence, and the single-chain primer can be used as an upstream primer, a downstream primer and a template through the palindromic sequence, so that the problem that template residues are easy to occur in the amplification process by adopting a single template and a single primer in the prior art is avoided, and efficient purification after amplification is facilitated; the single-chain primer disclosed by the invention is suitable for amplification of small fragments of 50-100bp in a DNA marker, so that not only is the amplification cost reduced, but also the efficiency is improved; and by adopting the preparation method disclosed by the invention, the large-scale production efficiency of the DNA marker can be improved, and the cost is effectively reduced.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner 北京擎科生物科技股份有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More