Carbonyl Reductase Mutant and Its Application in Catalytic Synthesis of 17β-Hydroxysteroids

A technology of hydroxysteroids and reductase, which is applied in the field of enzymes and enzyme engineering, can solve the problems of low conversion efficiency, low substrate concentration, and low conversion efficiency, and achieve simple and convenient preparation methods, less by-products, and short conversion time Effect

Active Publication Date: 2022-04-05
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since the 1930s, researchers have begun to use different microorganisms to transform 17-carbonyl steroids to achieve the synthesis of 17β-hydroxy steroids, but there are problems such as low conversion efficiency and many by-products
17β-hydroxysteroid dehydrogenase is the enzyme that catalyzes the final step in the synthesis of sex hormones. It can catalyze the reduction and oxidation reaction between the carbonyl and hydroxyl at the C17 position of steroid compounds. Some researchers use this type of enzyme as a biocatalyst To convert 17-carbonyl steroids to synthesize 17β-hydroxy steroids (Minglong Shao, Xian Zhang, Zhiming Rao, et al. Green Chemistry, 2016 (18): 1774-1784), but the conversion efficiency is not high, the required bacteria Large volume, low substrate concentration for conversion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl Reductase Mutant and Its Application in Catalytic Synthesis of 17β-Hydroxysteroids
  • Carbonyl Reductase Mutant and Its Application in Catalytic Synthesis of 17β-Hydroxysteroids
  • Carbonyl Reductase Mutant and Its Application in Catalytic Synthesis of 17β-Hydroxysteroids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Preparation of wild-type carbonyl reductase (RasADH) recombinant expression plasmid and recombinant expression transformant

[0032] After the sequence of SEQ ID No.1 was fully synthesized, it was connected to the pET21a vector, and then transformed into E. coli BL21(DE3) competent cells, and positive clones were picked to obtain the recombinant expression transformant E.coli BL21(DE3) / pET-21a-RasADH.

Embodiment 2

[0033] Embodiment 2: Carbonyl reductase RasADH mutant construction

[0034] In order to improve the activity of wild-type carbonyl reductase RasADH (its amino acid sequence is SEQ ID No.1, and its coding nucleotide sequence is SEQ ID No.3), site-directed saturation mutation was carried out at position 205, and the specific steps are as follows:

[0035] (i) Introduce mutations: design forward and reverse primers according to the nucleotides shown in SEQ ID No.3, and the specific primers are shown in Table 1 below:

[0036] Table 1

[0037] site upstream primer downstream primer F205A CTGCGTGCTAAAGCTGCTGCTGCTACC GGTAGCAGCAGCAGCAGCTTTAGCACGCAG F205R CTGCGTGCTAAAAGGGCTGCTGCTACC GGTAGCAGCAGCCTTTTAGCACGCAG F205K CTGCGTGCTAAAAAGGCTGCTGCTACC GGTAGCAGCAGCCTTTTTAGCACGCAG F205I CTGCGTGCTAAAATTGCTGCTGCTACC GGTAGCAGCAGCAATTTTAGCACGCAG F205H CTGCGTGCTAAACATGCTGCTGCTACC GGTAGCAGCAGCATGTTTAGCACGCAG F205L CTGCGTGCTAAACTTGCTGCTG...

Embodiment 3

[0053] Example 3: Construction of recombinant cells co-expressed with carbonyl reductase RasADH mutant and glucose dehydrogenase (GDH)

[0054] Using the RasADH mutant gene constructed in Example 2 and the existing glucose dehydrogenase gene in the laboratory as templates, these mutant genes and GDH genes were amplified by means of PCR, and after purification, they were respectively connected to the co-expression vector pRSFDuet. The two reading frames were successfully verified and transformed into Escherichia coli competent BL21 (DE3), and positive clones were picked to obtain recombinant cells co-expressing the RasADH mutant and GDH.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a carbonyl reductase mutant and its application in catalytically synthesizing 17β-hydroxy steroid compounds. The mutant has a mutation in a core amino acid of the wild-type carbonyl reductase. The mutants provided by the invention can significantly improve the ability of carbonyl reductase to convert a series of 17-carbonyl steroid compounds, and have high stereoselectivity. The recombinant cell provided by the invention is used as a biocatalyst, which can obtain a high yield target product with a high substrate feeding concentration, has few by-products, and the yield is not lower than 95%, and the conversion time is short, and the amount of the biocatalyst used is small, The space-time yield is much higher than the current reported level, the preparation method is simple and convenient, the conditions are mild, and the environment is friendly.

Description

technical field [0001] The invention relates to the field of enzymes and enzyme engineering. Specifically, the invention relates to the application of carbonyl reductase mutants in catalyzing the synthesis of 17-carbonyl steroid compounds into 17β-hydroxy steroid compounds. Background technique [0002] Steroidal drugs have strong pharmacological effects such as anti-infection, anti-allergy, anti-virus and anti-shock. With the continuous development of the times, steroid drugs have become the second largest class of drugs after antibiotics. Classification of steroid hormone drugs: adrenocortical hormones, including hydrocortisone, prednisone, etc., which can treat Addison’s disease, anti-inflammatory, anti-allergic, anti-shock, etc.; anabolic hormones, whose main physiological functions are Inhibit protein dissimilation and promote protein synthesis, mainly used to treat diseases caused by protein increase and insufficient synthesis; sex hormones, including estrogen, androg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/04C12N15/53C12P33/18
CPCC12N9/0006C12P33/18C12Y101/01184
Inventor 王玉陈曦张红榴刘祥涛冯进辉吴洽庆朱敦明马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap