Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Xylanase GH11-xyllanase mutant and application of xylanase GH11-xyllanase mutant

A xylanase mutation and mutant technology, applied in the field of xylanase GH11-xylanase mutants, can solve problems such as high cost of enzymes

Active Publication Date: 2021-04-16
杭州荔枝红生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main way of xylanase production is to use xylanase to hydrolyze xylan, but this method has the disadvantage of high enzyme cost, and the use of protein engineering to improve the activity and thermal stability of xylanase has no effect on reducing xylanase. Production costs are significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylanase GH11-xyllanase mutant and application of xylanase GH11-xyllanase mutant
  • Xylanase GH11-xyllanase mutant and application of xylanase GH11-xyllanase mutant
  • Xylanase GH11-xyllanase mutant and application of xylanase GH11-xyllanase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Determination of key amino acid residues in the active framework of xylanase GH11-xylanase

[0031] The xylanase GH11-xylanase selected in the present invention is a typical endo-degrading enzyme, and the final products of its hydrolysis of xylan are mainly xylobiose and xylotriose. Studies have shown that xylanases from different sources have different substrate specificities and can produce xylooligosaccharides with different degrees of polymerization. The present invention found that the xylanase BsCel5A derived from B. subtilis 168 has the highest sequence similarity (99%) with the xylanase GH11-xylanase through BLAST search, and obtained the crystal of xylanase BsCel5A in the PDB database structure (PDB ID: 3PZT), using it as a template, the three-dimensional structure model of xylanase GH11-xylanase (SEQ ID No: 1) was constructed ( figure 1 A). Then, through self-established screening principles, combined with PDB and CAZy database analysis, and compre...

Embodiment 2

[0033] Example 2 Construction of xylanase GH11-xylanase mutant library

[0034] Analyze the relative position of SEQ ID No: 1 sequence 33-36 hotspot amino acid residues (see figure 2 ), it was found that Y33 and Q35 are closer, and the side chain substitutions of the two may have a greater impact on each other, so Y33 and Q35 were subjected to iterative saturation mutation (see image 3 ), saturation mutations were performed on W34 and N36, which were relatively far away.

[0035] Taking the W34 site as an example, the construction method of its mutant library is as follows, and the primers used are shown in the following table:

[0036] Primer Sequence(5' to 3') W34C-F GGCGCTAGCACAGACTACTGCCAAAATTGGACTGATG SEQ ID NO: 4 W34D-F GGCGCTAGCACAGACTACGACCAAAATTGGACTGATG SEQ ID NO: 5 W34E-F GGCGCTAGCACAGACTACGAACAAAATTGGACTGATG SEQ ID NO: 6 W34F-F GGCGCTAGCACAGACTACTTTCAAAATTGGACTGATG SEQ ID NO: 7 W34G-F GGCGCTAGCACAGACTACGGTCA...

Embodiment 3

[0038] Fermentation of embodiment 3 recombinant xylanase mutants in Escherichia coli

[0039] Each of the W34 mutants constructed in Example 2 and the original enzyme GH11-xylanase were inoculated into 50 mL of LB liquid medium containing 100 μg / mL kanamycin sulfate, and cultured overnight at 37° C. at 180 rpm; at an inoculum size of 2% Inoculate the seed solution into fresh 50mL LB liquid medium, cultivate to OD at 37°C and 180rpm 600 When it is 0.6-1.0, take it out and cool it in an ice-water bath for 5 minutes, add the inducer IPTG (isopropyl-β-D thiogalactopyranoside) (final concentration 0.1mmol / L), induce expression at 20°C, 150rpm for 20h.

[0040] Get the fermented liquid of induced expression, centrifuge at 12000rpm for 20min, discard the supernatant, then wash with 50mM Na 2 HPO 4 -KH 2 PO 4 (pH 7.0) buffer to resuspend and wash the bacterial cells, centrifuge at 12000rpm for 20min, discard the supernatant, resuspend with buffer, and then sonicate. The broken li...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

According to the invention, xylanase GH11-xlanase is taken as a template, amino acid mutation is carried out by adopting a molecular biotechnology, mutants with high catalytic efficiency are obtained, the mutants comprise mutation of one or more sites in W34F and Q35H, and the mutants can further have N36Y mutation. The mutant disclosed by the invention has the excellent property of high catalytic efficiency, is beneficial to reducing the use cost of xylanase and improving the conversion efficiency of producing xylooligosaccharide by using the xylanase, and has a wide industrial application prospect.

Description

technical field [0001] The invention belongs to the technical field of functional gene modification, and specifically relates to a kind of xylanase GH11-xylanase mutant and application thereof. Background technique [0002] Hemicellulose, one of the three major components of plant cell walls, is one of the most abundant and cheapest renewable resources on earth. As the main component of hemicellulose, xylan is composed of β-D-xylose units connected by β-1,4 glycosidic bonds in its main chain. Xylanase has the activity of hydrolyzing β-1,4-xylosidic bonds in the carbon skeleton of xylan, thereby producing xylooligosaccharides. [0003] High-quality xylo-oligosaccharides have broad application prospects in the fields of food, medicine, and feed. Its sweet taste is pure, and it is the beneficial bacteria with "the most stable performance, the strongest functionality, and the least intake" among all functional sugars. factor. Xylobiose and xylotriose are the main functional c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/56C12N15/70C12N1/21C12P19/00C12P19/02C12P19/12C12P19/14C12R1/19
CPCY02P60/87
Inventor 何红丽
Owner 杭州荔枝红生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com