Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transcription factor GhWRKY1-like gene for regulating verticillium dahliae resistance and drought resistance of cotton and application

A cotton verticillium wilt and transcription factor technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of narrowness, low selection efficiency, long cycle, etc.

Active Publication Date: 2021-02-05
HUBEI UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing cotton drought-resistant germplasm resources in my country are relatively limited. For many years, people have used traditional breeding methods to solve the drought-resistant problem of cotton varieties, but it often costs a lot of money, takes a long time, and the selection efficiency is not high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transcription factor GhWRKY1-like gene for regulating verticillium dahliae resistance and drought resistance of cotton and application
  • Transcription factor GhWRKY1-like gene for regulating verticillium dahliae resistance and drought resistance of cotton and application
  • Transcription factor GhWRKY1-like gene for regulating verticillium dahliae resistance and drought resistance of cotton and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039]Example 1: GhWRKY1-like gene isolation and cloning

[0040]1. Obtain the gene sequence

[0041]The applicant’s preliminary work was to analyze the expression profile data of upland cotton YZ1 (upland cotton YZ1 from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences) after inoculation with Verticillium dahliae V991, combined with the VIGS method, and identified a positively regulated cotton verticillium wilt resistance Gene. Sequence alignment in the NCBI database revealed that the gene is highly homologous to the GaWRKY1-like and GaWRKY95 genes in Asian cotton (Gossypium arboretum) and Gossypium hirsutum. At the same time, referring to the latest upland cotton genome annotations, the isolated genes Named as GhWRKY1-like (see the evolutionary tree analysis of the genefigure 1 ).

[0042]Using primers GhWRKY1-like-F (5'ATGGTTCCGTCAGGGGAGTGTG 3') and GhWRKY1-like-R (5'TCAAGGACCTGATATAGGTGCA 3'), the full-length sequence of GhWRKY1-like was cloned using the cDNA...

Embodiment 2

[0047]Example 2: Using VIGS method for gene silencing

[0048]1. Greenhouse nursery

[0049]Select the full-grained cotton line YZ1 seeds, soak them in warm water at 25°C for 2h, and then spread them flat on the soaked gauze, cover them with a layer of moist gauze, and place them in an incubator at 28°C for germination. When the roots of the seeds grow to 1-2cm, they can be transplanted into nutrient soil (volume ratio, nutrient soil: vermiculite=3:1). Gently put the seedling roots into the nutrient soil, and cover with 1-2cm thick nutrient soil, then cover with plastic wrap, and cultivate under light. Set the culture temperature to 28℃ and the light time to 16h. Wait for the seedlings to break the soil. After that, unmask the film. When the cotyledons of the seedlings are fully expanded, the Agrobacterium can be injected and the VIGS test can be performed.

[0050]2. Activation and preservation of Agrobacterium

[0051]2.1 Preparation:

[0052]The Agrobacterium strain is GV3101, prepare a sterile...

Embodiment 3

[0076]Example 3: Agrobacterium-mediated genetic transformation of cotton and Arabidopsis

[0077]Design primers according to the ORF of GhWRKY1-like, and add attB1 and attB2 recombination exchange sites at both ends of the primers, using primers OE-GhWRKY1-like-F (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGTTCCGTCAGGGGAGTGTG 3') and RT-GhWRKY1-like-R (5'GGGGACCACTTTGTACAAGAAAGCTGGGTTTCAAGGACCTGATATAGGTGCA 3'), and then use the cDNA of the GhWRKY1-like gene as a template for PCR amplification, and the resulting PCR product is constructed on the pGWB417 vector by the Gateway recombination reaction to obtain an overexpression vector. The overexpression vector contains the nucleotide sequence shown in SEQ ID NO. 2 and the plant expression vector pGWB417. The methods and procedures for genetic transformation of cotton mediated by Agrobacterium GV3101 (Roger et al., A guide to Agrobacterium binary Ti vectors. Trends in plantscience. 2000.5, 1360-1385) refer to the high-efficiency transformation sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and relates to a transcription factor GhWRKY1-like gene for regulating verticillium dahliae and drought resistance of cottonand application. RAN-Seq data at different time points after upland cotton is inoculated with verticillium dahliae bacteria are analyzed, a transcription factor gene GhWRKY1-like expressed by verticillium dahliae is obtained through screening, and the nucleotide sequence of the transcription factor gene GhWRKY1-like is shown as SEQ ID NO: 1; and the protein sequence is shown as SEQ ID NO: 2. A VIGS system is utilized, verticillium dahliae is inoculated after GhWRKY1-like is silenced in cotton, and it is rapidly proved that the gene has a forward regulation effect on verticillium dahliae resistance of the cotton. GhWRKY1-like overexpressed cotton and arabidopsis thaliana materials are utilized to further verify the forward regulation function of the gene in verticillium dahliae resistance and drought resistance, that is, overexpression of the gene can significantly improve the resistance of plants to verticillium dahliae and drought.

Description

Technical field[0001]The invention belongs to the technical field of plant genetic engineering, and specifically relates to a transcription factor GhWRKY1-like gene that regulates cotton resistance to Verticillium wilt and drought and its application. RAN-Seq data at different time points after upland cotton YZ1 inoculated with Verticillium dahliae V991 was analyzed, and a series of WRKY transcription factors induced by Verticillium wilt were screened. Through the VIGS system, the corresponding genes were silenced in cotton, and Verticillium dahliae was further inoculated to quickly identify its function in cotton Verticillium wilt resistance. Among them, the identified GhWRKY1-like gene can positively regulate the resistance of cotton to Verticillium wilt, that is, silencing this gene can significantly increase the resistance of cotton to Verticillium wilt. The gene is overexpressed in cotton and Arabidopsis, and the transgenic materials can significantly improve the resistance of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H5/10A01H6/60A01H6/20
CPCC07K14/415C12N15/8218C12N15/8273C12N15/8282
Inventor 胡琴张献龙朱龙付杜雪竹盛锋
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com