Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof
A detection kit and protein antigen technology, applied in the field of protein detection, can solve the problems of limited, no ANR1 and ANR2 antibodies for sale, and inability to detect expression, etc., to achieve the effect of strong immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0044] The invention provides an antibody against tea tree anthocyanin reductase 1 and anthocyanin reductase 2 protein antigens, which is produced by immunizing animals with the above immune antigens. The antibodies preferably include monoclonal antibodies and polyclonal antibodies. The preparation method of the polyclonal antibody preferably includes the following steps: dilute the above immune antigen to 1 mg / mL, emulsify it with Freund's complete adjuvant at a ratio of 1:1 by volume, and inject it subcutaneously on the neck and back of two New Zealand white rabbits. Multi-point injections (1 mL per mouse) were used for immunization, 4 times at intervals of 2 weeks, and blood was collected to detect the antibody titer by ELISA method; after the antibody titer reached 1:80000, the serum was collected and purified, ELISA and western After blot identification, polyclonal antibodies against ANR1 and ANR2 were obtained. When the antibody is a monoclonal antibody, the present inv...
Embodiment 1
[0048] Design and synthesis of embodiment 1ANR1 and ANR2 protein polypeptide
[0049] (1) According to the ANR1 and ANR2 gene sequences (SEQID No.3~No.4) cloned in Yinghong No.9 and Nankunshan Maoyecha tea plants, ANR1 and ANR2 in different tea tree resources were obtained by Blast search on GenBank Gene.
[0050] ANR1 gene sequence (SEQ ID No.3):
[0051] ATGGAAGCCCAACCGACAGCTCCGAAGGCCGCATGTGTTGTTGGTGGCACCGGCTTCGTGGCGGCGACGCTCATCAAGTTGTTGCTTGAGAAAGGCTATGCGGTCAACACCACTGTCCGAGACCCAGGCAATCAGAAAAAGACCTCTCACCTTCTAGCACTAAAGGGTTCAGGCAACCTAAAAATCTTCCGAGCAGACCTCACCGATGAACAGAGCTTTGACGCCCCTGTAGCGGGTTGTGACCTGGTCTTCCATGTCGCTACACCAGTCAACTTTGCTTCCGAGGATCCAGAGAATGACATGATAAAACCAGCAATTCAAGGAGTAGTCAATGTTCTAAAAGCTTGTGCAAAAGCAGGAACGGTTAAACGTGTCATTTTAACATCATCAGCAGCTGCTGTATCGATCAATAAGCTCAATGGGACCGGCCTGGTCATGGATGAGAGTCACTGGACTGACACCGAGTTTTTGAATTCTGCGAAGCCGCCCACTTGGGGGTACCCTTTATCGAAAACACTAGCTGAGAAAGCTGCTTGGAAGTTTGCCGAAGAAAATAACATTAATCTTATCACTGTCATCCCAACTCTCATGGCCGGTCCGTCACTTACTGCAGATGTCCCTAGCAGTATTGG...
Embodiment 2
[0058] 1. ANR1 and ANR2 protein antigen polypeptide preparation and immunization method
[0059] 1. ANR1 protein antigen polypeptide (NQKKTSHLLALKGS) and ANR2 antigen polypeptide (NFASEDPENDMIKPA) were synthesized by Qiangyao Biotechnology Company.
[0060] 2. Both ANR1 and ANR2 antigen polypeptides are coupled with KLH and BSA to prepare immune antigens and detect antigens
[0061] (1) Using the SMCC kit (purchased from Thermo Fisher Scientific) to couple the ANR1 and ANR2 antigen polypeptides to KLH respectively (the coupling agent is Sulfo-SMCC) to prepare immune antigens. The specific method is: weigh 4 mg of the ANR1 and ANR2 antigen polypeptides Dissolve in 0.4mL of PBS (pH 7.2, the same below), add 4mg of Sulfo-SMCC, incubate at 4°C for 2h, then add 25mg of KLH solution (concentration: 20mg / mL) to ANR1-SMCC and ANR2-SMCC , reacted at 4°C for 2h, and dialyzed in PBS buffer for 24h to obtain ANR1-KLH and ANR2-KLH immune antigens, which were stored at -20°C.
[0062] The...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com