A barcode identification primer, identification method and kit for different species within Aeromonas

Abstract

The invention discloses barcode identification primers, identification methods and kits of different species within the genus Aeromonas. It includes F: 5’‑GGAATTCGCAACCGTTCTGGCTCAGGCTATCGT‑3’; R: 5’‑TGTCGACGACGGCAGCCACTTTCAC‑3’. 16S rRNA sequence analysis and identification methods generally believe that the sequence similarity of more than 97% is regarded as the same level, but in practical applications, multiple different species of Aeromonas often meet the sequence similarity requirements. In this case, 16S rRNA sequence analysis can only identify the genus level and cannot accurately identify the species. The invention can solve the above problems. After the cpn60 sequences of the species to be tested are compared by BLAST, the comparison results satisfying the similarity greater than 98.8% and the coverage greater than 98% are highly specific, and are a specific species of the genus Aeromonas. There are no cases of different species present in the results.

Description

Technical field: [0001] The invention belongs to the technical field of biology, and in particular relates to barcode identification primers, identification methods and kits of different species within the genus Aeromonas. Background technique: [0002] Aeromonas spp, belonging to the Vibrio family, is a facultative anaerobic, Gram-negative bacterium, widely distributed in aquatic habitats such as rivers, lakes, ponds, seawater, and estuaries. Aeromonas can infect a variety of animals, causing disease and even death of animals, posing huge challenges to the aquaculture industry. In addition, pathogenic Aeromonas can also cause acute diarrhea, bacteremia, meningitis, endocarditis and other diseases, which brings hidden dangers to public health safety and affects human health. Therefore, how to quickly and accurately identify pathogenic bacteria, so as to control the disease in a targeted manner, is of great significance in production practice. [0003] At present, the detec...

AI Technical Summary

Problems solved by technology

The difference between the 16SrRNA genes of different species of Aeromonas is low, only 0.06% to 0.66%. According to the commonly used standard, if the sequence similarity reaches more than 97%, it is regarded as the same level. However, using 16SrRNA sequence for analysis may cause The similarity with two or more species is greater than 97%, which leads to the inability to accurately identify the species

Images