Oilseed rape BnMAN7 gene and application thereof
A gene and rape technology, which is applied to the rape BnMAN7 gene and its application field to achieve the effects of high reliability, easy mechanized harvesting, and enhanced silique crack resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1. BnMAN7 Gene acquisition
[0031] Arabidopsis hemicellulase gene MANNANASE7 (The nucleotide sequence is shown in SEQ ID NO.20, the GENEBANK database accession number is: BT008749.1, the amino acid sequence is shown in SEQ ID NO.21, the GENEBANK database accession number is: AAP49511.1), in the database For rape gene screening, it was finally confirmed that BnaA07g12590D (nucleotide sequence shown in SEQ ID NO.1) was used as the research object, and further cloned from Brassica napus Zhongshuang 11 (seeds were purchased from Wuhan Zhongyou Seed Industry Technology Co., Ltd.) This gene was studied and its function was studied, and the cloned gene was named BnMAN7 ,Specific steps are as follows:
[0032] (1) Plant material cultivation:
[0033] The Brassica napus Zhongshuang No. 11 plant (the seeds were purchased from Wuhan Zhongyou Seed Industry Technology Co., Ltd. and planted by our laboratory) was used as the experimental material, and the growth conditi...
Embodiment 2
[0051] Example 2. BnMAN7 Tissue-specific expression pattern analysis of genes
[0052] to explore genes BnMAN7 The differential expression in various tissues of Brassica napus was detected by q-PCR technology BnMAN7 Expression patterns in Brassica napus roots, stems, shoot tips, leaves, flowers, flower buds, young siliques (15 days after anthesis), mature siliques (50 days after anthesis). The plant material used in this example is Brassica napus Zhongshuang No. 11. Each tissue material was collected and immediately frozen with liquid nitrogen, and stored in a -70°C ultra-low temperature refrigerator for later use. According to the method in Example 1, RNA from various tissues of rapeseed was obtained and cDNA was synthesized.
[0053] exist BnMAN7 Real-time fluorescent quantitative PCR primers were designed for the non-conserved region of the gene sequence, and the primer sequences were:
[0054] qman7-F (SEQ ID NO.7): 5'-AGACTCGAACGAGCAATCCC-3'
[0055] qman7-R (SEQ ID...
Embodiment 3
[0058] Example 3. Inhibition BnMAN7 Obtaining Transgenic Rapeseed Plants with Gene Expression
[0059] (1) Inhibition BnMAN7 Expressed RNAi vector construction:
[0060] Constructed in embodiment 1 step (3) BnMAN7 -pMD19-T recombinant plasmid as template, amplified BnMAN7 The 158bp specific fragment on the gene is a non-conserved fragment of the gene. Interfering with this sequence will cause the gene to be silenced and lose its function. The specific nucleotide sequence of this fragment is shown in SEQ ID NO.9, specifically: :
[0061] ATGAAGCCCTCTGTGTCTGGTTACAATCCTATCGATCCTGATCCAACAAAGCTATTTGAAGCTCGGAGCAGATGCGTTTTCGAGAGATGGGTTCGTGAGAACGAAAGGTGTTCAGTTTAGCCTCAATGGCTATCCTTATTACGCTAATGGCTTCAATGC
[0062] The primer sequences used for amplification are:
[0063] Iman7-F (SEQ ID NO.10): 5'-CACCATGAAGCCCTCTGTGTCTGGTTA-3'
[0064] Iman7-R (SEQ ID NO.11): 5'-GCATTGAAGCCATTAGCGTA-3'
[0065] Primers were synthesized by Shanghai Shenggong Company.
[0066] Use the high-fidelit...
PUM
Property | Measurement | Unit |
---|---|---|
length | aaaaa | aaaaa |
hydrophilicity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com