Fluorescent quantitation PCR detection method of gyrovirus3 GyV3

A circovirus, fluorescent quantitative technology, applied in the field of molecular biology, to achieve the effect of simple detection, accurate quantification, and rapid detection

Pending Publication Date: 2020-03-31
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports of various detection methods for this virus at home and abroad, so the real-time fluorescent quantitative PCR detection method of chicken new orbivirus GyV3 established in this study is the only detection method for this virus at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitation PCR detection method of gyrovirus3 GyV3
  • Fluorescent quantitation PCR detection method of gyrovirus3 GyV3
  • Fluorescent quantitation PCR detection method of gyrovirus3 GyV3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036] The fluorescent quantitative PCR detection of embodiment chicken novel orbivirus GyV3

[0037] 1. Relevant experimental pathogens: IBV, IBDV, ILTV, H5, H9, Reov, FAV, REV, ARV, CAV, all identified and preserved by the Institute of Poultry, Shandong Academy of Agricultural Sciences.

[0038] 2. Primer design: refer to the existing gene sequence of the chicken novel orbivirus GyV3, perform comparison, select the conserved region, and design specific primers for the PCR method for real-time fluorescence quantitative detection of the chicken novel orbivirus GyV3. The present invention designs four pairs of primers (9-Gyv3, 10-Gyv3, 11-Gyv3, 12-Gyv3), performs amplification and sensitivity comparison tests on these four pairs of primers, and finally screens out sequences with high sensitivity and good specificity used in the establishment of this method.

[0039] The designed specific primer sequences are:

[0040] Upstream primer 9-GyV3 forward: 5'TCCAATAAGTTCGTCGGAGTC 3'...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a specific primer for detecting gyrovirus3 GyV3. The specific primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is as shown in SEQID NO.1, and the nucleotide sequence of the downstream primer is as shown in SEQID NO.2. A fluorescent quantitation PCR detection method of the gyrovirus3 GyV3 comprises the stepsof (1) performing a real-time fluorescent quantitation PCR reaction: extracting genome DNA of substances to be detected, performing PCR amplification through the specific primer, and deducing a standard linear regression equation (standard curve); and (2) performing result judgment: judging samples free from Ct value and free from an amplification curve to be feminine, and judging samples of whichthe Ct value is smaller than or equal to 36 and in which a typical amplification curve appears to be positive. According to the established method disclosed by the invention, safe, specific, quick, acute and simple quick detection of GyV3 can be realized, so that a method is provided for epidemiological investigation and early diagnosis of the gyrovirus3 GyV3, the specific primer has important significance, and the blank in relevant field at home and abroad is filled.

Description

technical field [0001] The invention relates to a fluorescent quantitative PCR detection method of a new chicken orbivirus GyV3, belonging to the technical field of molecular biology. Background technique [0002] Chicken new orbivirus (Gyrovirus3, GyV3) is a newly discovered pathogen that can cause chicken gastritis in recent years. At present, this virus belongs to the second single-stranded circular DNA virus identified in chicken flocks, the first Single-stranded circular DNA virus is a chicken infectious anemia. GyV3 virus can cause symptoms such as immunosuppression, anemia, and glandular stomach enlargement. In view of the hazards of this virus, it is urgent to establish a rapid and sensitive detection method for early diagnosis and effective protection of animals. [0003] The real-time fluorescent quantitative PCR method (Real time PCR) is a method for detecting the total amount of products after each cycle of the polymerase chain reaction (PCR) with a fluorescent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 田雪李玉峰于可响胡峰刘存霞黄兵宋敏训
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products