Fluorescent quantitation PCR detection method of gyrovirus3 GyV3
A circovirus, fluorescent quantitative technology, applied in the field of molecular biology, to achieve the effect of simple detection, accurate quantification, and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0036] The fluorescent quantitative PCR detection of embodiment chicken novel orbivirus GyV3
[0037] 1. Relevant experimental pathogens: IBV, IBDV, ILTV, H5, H9, Reov, FAV, REV, ARV, CAV, all identified and preserved by the Institute of Poultry, Shandong Academy of Agricultural Sciences.
[0038] 2. Primer design: refer to the existing gene sequence of the chicken novel orbivirus GyV3, perform comparison, select the conserved region, and design specific primers for the PCR method for real-time fluorescence quantitative detection of the chicken novel orbivirus GyV3. The present invention designs four pairs of primers (9-Gyv3, 10-Gyv3, 11-Gyv3, 12-Gyv3), performs amplification and sensitivity comparison tests on these four pairs of primers, and finally screens out sequences with high sensitivity and good specificity used in the establishment of this method.
[0039] The designed specific primer sequences are:
[0040] Upstream primer 9-GyV3 forward: 5'TCCAATAAGTTCGTCGGAGTC 3'...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap