A triple fluorescent quantitative PCR detection method and kit for Rhizoctonia solani of cruciferous vegetables
A technology of cruciferous vegetables and Rhizoctonia solani, applied in the field of molecular biology, can solve problems such as difficult to distinguish, time-consuming disease detection, laborious fungal compound infection, etc., and achieve simple operation, shortened detection time, and high sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Synthesis of primers and probes
[0059] Synthesis of primers and probes for triple fluorescence quantitative PCR detection of R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII, the specific steps are as follows:
[0060] (1) Primers and probes of R. solani fusion group AG-2-1:
[0061] AG-2-1 upstream primer: 5'-GCTACAACCCCAAGTCGG-3' (SEQ ID NO: 1)
[0062] AG-2-1 downstream primer: 5'-GTAAAAGCGTAAAACCTGGGTG-3' (SEQ ID NO: 2)
[0063] AG-2-1 probe: 5'-FAM-CCTATCTCTGGATGGCACGGTGAC-TAMRA-3' (SEQ ID NO:3);
[0064] (2) Primers and probes of R. solani fusion group AG-1-IB:
[0065] AG-1-IB upstream primer: 5'-AACAAGATGGACACTACCAAGG-3' (SEQ ID NO:4)
[0066] AG-1-IB downstream primer: 5'-GGTCCTCGCTCCACTATAAAG-3' (SEQ ID NO:5)
[0067] AG-1-IB probe: 5'-VIC-AGTACAAACTCCACTCGGGTAACGACA-TAMRA3' (SEQ ID NO: 6);
[0068] (3) Primers and probes of R. solani fusion group AG-4HGII:
[0069] (1) AG-4HGII upstream primer: GCGCGGTAAAGGAATTTTGC (SEQ ID NO: 7)
[00...
Embodiment 2 3
[0072] Example 2 Preparation of triple fluorescent quantitative PCR detection premix
[0073] The preparation of triple fluorescent quantitative PCR detection mixture, the specific steps are as follows:
[0074] The following components synthesized in Example 1 were mixed well to obtain a mixed solution for the detection of R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII by triple fluorescence quantitative PCR.
[0075] AG-2-1 upstream primer: 0.2μL / test;
[0076] AG-2-1 downstream primer: 0.2μL / test;
[0077] AG-2-1 probe: 1μL / test;
[0078] AG-1-IB upstream primer: 0.3μL / test;
[0079] AG-1-IB downstream primer: 0.3μL / test;
[0080] AG-1-IB probe: 1μL / test;
[0081] AG-4HGII upstream primer: 0.2μL / test;
[0082] AG-4HGII downstream primer: 0.2μL / test;
[0083] AG-4HGII probe: 1 μL / test;
[0084] qPCR MIX: 10.4 μL / test;
[0085] Double distilled water: 4.2 μL / test.
Embodiment 3
[0086] The preparation of embodiment 3 positive control substance
[0087] Preparation of positive controls in the triple fluorescent quantitative PCR detection kit for R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII:
[0088] (1) Construction of plasmid
[0089] 1. Construction of the R. solani fusion group AG-2-1 plasmid: PCR was used to amplify the nucleic acid of the R. solani fusion group AG-2-1 sample (preserved by the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences). , the obtained sequence is:
[0090] 5'-GCTACAACCCCAAGTCGGTCGCTTTCGTCCCTATTTCTGGATGGC ACGGTGACAACATGTTGGAGGAGTCCGTCAAGTACGTCATACTGTCGCACCCAGGTTTACGCTTTTAC-3' (SEQ ID NO: 10) nucleic acid fragment of the target amplification sequence, the primer sequences are shown in SEQ ID NO: 1-3. After purification of the amplified fragment, it was cloned into pMD19-T vector by TA, and the recombinant vector with correct sequencing result was transformed into DH5α and amplified to obt...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com