Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses

A technology for detecting spleen and kidney necrosis virus and primers, which is applied in the directions of microorganism-based methods, microorganisms, biochemical equipment and methods, etc., which can solve the problems of time-consuming, expensive, and inability to accurately detect samples with low virus content, and simplify the operation steps. , the effect of high sensitivity

Pending Publication Date: 2019-12-10
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional separation and identification methods have the disadvantages of requiring expensive instruments and equipment and taking a long time
Although PCR, qPCR and LAMP have the characteristics of high sensitivity, strong specificity, and easy operation compared with...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses
  • Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses
  • Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] This embodiment provides a digital PCR detection kit for detecting ISKNV, including RNase-free distilled water, one-step ddPCR probe method master mix, probe method ddPCR droplet generation oil, quality control solution, negative control and positive control.

[0024] The one-step ddPCR probe method master mix includes: 500 μL of 2×One-step ddPCR Supermix forprobes, 50 μL of upstream and downstream primers, 50 μL of specific probes, the concentration of both primers and probes is 10 μM, and RNase-free Enzyme distilled water 300 μL for a total volume of 950 μL.

[0025] The positive control is a plasmid containing the genome of infectious spleen and kidney necrosis virus, and the negative control is RNase-free distilled water.

[0026] The nucleotide sequences of the primers and probes are as follows:

[0027] ISKNV-F:CACCCTGGCTAACATTGGCA (SEQ ID NO:1)

[0028] ISKNV-R: CACAACCTCACGCTCCTCAC (SEQ ID NO: 2)

[0029] ISKNV-Probe: FAM-ACCCGCACTGACCAACGTGTCCGT-MGB (SEQ ID...

Embodiment 2

[0031] This embodiment provides a digital PCR detection method for detecting ISKNV, using the kit of Example 1 for detection, and the specific detection method includes the following steps:

[0032] (1) Extract the DNA of the sample to be tested and use it as a PCR reaction template.

[0033] (2) Prepare a ddPCR reaction solution with a volume of 20 μL. The formula is: 18 μL of one-step ddPCR probe method master mix (including the primers, probes and RNase-free distilled water), and 2 μL of DNA template for the sample to be tested.

[0034] (3) To prepare micro-droplets, add 20 μL of ddPCR reaction solution and 70 μL of micro-droplet generating oil to the sample hole and oil level hole respectively according to the marked position on the droplet generating plate, and then place the base fixed with the micro-droplet generating card on the micro-droplet Generate microdroplets in the generator; transfer all the microdroplets (generally about 42 μL) generated in the droplet genera...

Embodiment 3

[0038] This embodiment verifies the specificity of the detection primers and probes provided by the present invention, the specific operations are as follows:

[0039] Utilize the kit described in Example 1 and the method described in Example 2 to detect the virus DNA to be tested, set a positive control group (ISKNV positive plasmid) and a negative control group (no RNase distilled water) at the same time, use the test Viruses include largemouth bass iridovirus (Largemouth bass Virus, LMBV), grouper iridovirus (SGIV), frog virus (Frog Virus 3, FV3), soft-shelled tutleiridovirus (STIV), mandarin fish Fish frog iridescent virus (Santee-Cooper RanaViruses, ScRIV).

[0040] Experimental results such as figure 1 As shown, only the positive control group (ISKNV) can detect the signal, and the other groups have no signal and are not negative, indicating that the primers and probes of this method have good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a digital PCR detection primer and specificity probe for detecting infectious spleen and kidney necrosis viruses. The primer is characterized in that the upstream nucleotide sequence of the primer is shown as SEQID NO:1, and the downstream nucleotide sequence of the primer is shown as SEQID NO:2. The nucleotide sequence of the specificity probe is shown as SEQID NO:3. The invention further provides a reagent kit including the digital PCR detection primer and the specificity probe and used for detecting infectious spleen and kidney necrosis viruses. The reagent kit and droplet digital PCR are combined for use to detect ISKNV viruses, the detection sensitivity is high, and a standard curve is not set. According to detection results, the nucleic acid copy number of ISKNV in samples can be directly red, and the operation steps can be greatly simplified.

Description

technical field [0001] The invention belongs to the technical field of virus detection in aquatic animals, and more specifically relates to primers and a kit for detection of infectious spleen and kidney necrosis virus droplet digital PCR. Background technique [0002] Infectious spleen and kidney necrosis virus (ISKNV) belongs to the family Iridoviridae and belongs to the genus Megalocytivirus. ISKNV has a wide range of hosts and can infect more than 50 species of marine and freshwater fish such as Perciformes, Killiformes, Herringoformes, Pufferiformes, Lanternidae, Mulletiformes and Flatfishes all over the world. Fu Xiaozhe et al. conducted a homology comparison of the outer membrane proteins of 33 strains of swollen viruses from different host sources and found that swollen viruses can be divided into 3 types, type I mainly infects seawater fish, type II mainly infects freshwater fish, Type III mainly infects flounder and flounder. ISKNV is divided into two genotypes, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/159
Inventor 林强李宁求付小哲刘礼辉梁红茹牛银杰
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap