Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses
A technology for detecting spleen and kidney necrosis virus and primers, which is applied in the directions of microorganism-based methods, microorganisms, biochemical equipment and methods, etc., which can solve the problems of time-consuming, expensive, and inability to accurately detect samples with low virus content, and simplify the operation steps. , the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] This embodiment provides a digital PCR detection kit for detecting ISKNV, including RNase-free distilled water, one-step ddPCR probe method master mix, probe method ddPCR droplet generation oil, quality control solution, negative control and positive control.
[0024] The one-step ddPCR probe method master mix includes: 500 μL of 2×One-step ddPCR Supermix forprobes, 50 μL of upstream and downstream primers, 50 μL of specific probes, the concentration of both primers and probes is 10 μM, and RNase-free Enzyme distilled water 300 μL for a total volume of 950 μL.
[0025] The positive control is a plasmid containing the genome of infectious spleen and kidney necrosis virus, and the negative control is RNase-free distilled water.
[0026] The nucleotide sequences of the primers and probes are as follows:
[0027] ISKNV-F:CACCCTGGCTAACATTGGCA (SEQ ID NO:1)
[0028] ISKNV-R: CACAACCTCACGCTCCTCAC (SEQ ID NO: 2)
[0029] ISKNV-Probe: FAM-ACCCGCACTGACCAACGTGTCCGT-MGB (SEQ ID...
Embodiment 2
[0031] This embodiment provides a digital PCR detection method for detecting ISKNV, using the kit of Example 1 for detection, and the specific detection method includes the following steps:
[0032] (1) Extract the DNA of the sample to be tested and use it as a PCR reaction template.
[0033] (2) Prepare a ddPCR reaction solution with a volume of 20 μL. The formula is: 18 μL of one-step ddPCR probe method master mix (including the primers, probes and RNase-free distilled water), and 2 μL of DNA template for the sample to be tested.
[0034] (3) To prepare micro-droplets, add 20 μL of ddPCR reaction solution and 70 μL of micro-droplet generating oil to the sample hole and oil level hole respectively according to the marked position on the droplet generating plate, and then place the base fixed with the micro-droplet generating card on the micro-droplet Generate microdroplets in the generator; transfer all the microdroplets (generally about 42 μL) generated in the droplet genera...
Embodiment 3
[0038] This embodiment verifies the specificity of the detection primers and probes provided by the present invention, the specific operations are as follows:
[0039] Utilize the kit described in Example 1 and the method described in Example 2 to detect the virus DNA to be tested, set a positive control group (ISKNV positive plasmid) and a negative control group (no RNase distilled water) at the same time, use the test Viruses include largemouth bass iridovirus (Largemouth bass Virus, LMBV), grouper iridovirus (SGIV), frog virus (Frog Virus 3, FV3), soft-shelled tutleiridovirus (STIV), mandarin fish Fish frog iridescent virus (Santee-Cooper RanaViruses, ScRIV).
[0040] Experimental results such as figure 1 As shown, only the positive control group (ISKNV) can detect the signal, and the other groups have no signal and are not negative, indicating that the primers and probes of this method have good specificity.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap