Gene detection method of amount of individual folic acid replenisher
A detection method and individual technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of long cycle, increased risk of DS children, and complicated operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Sample collection and DNA template preparation
[0046] 1) Use oral swabs to collect the oral epithelial cells of the person to be tested. The method is to insert the swab into the oral cavity so that the head of the swab fully contacts the mucous membranes on the inside of the cheek and the upper and lower gums, and rubs up and down with the force of brushing teeth, while rotating the swab. Let the swab head fully touch the oral mucosa, and repeat this action for 1 minute.
[0047] 2) Using the standard buccal swab DNA extraction kit and corresponding steps, place the swab stained with buccal cells in 800 μL of normal saline, rinse for 20 seconds to make the cells fall off completely, stick to the wall of the centrifuge tube and squeeze dry the swab. For liquid, centrifuge at 12,000rpm for 5min.
[0048] 3) Discard 700 μL of supernatant, and the remaining 100 μL of supernatant, fully shake and mix for 15 seconds, add 200 μL of lysate and 20 μL of digestion s...
Embodiment 2
[0055] Example 2 Design of primers for rs1801133, rs1801131, rs1805087 and rs1801394 loci
[0056] Specific amplification primers for different types of SNP sites were designed (the two primers differ only in the terminal bases, denoted by F1 and F2 respectively), and the corresponding reverse primers (denoted by R), 3 primer combinations Create a primer master mix. In addition, the 5' ends of the two forward primers are respectively connected with different detection sequences for fluorescence detection. Specific amplification primers are underlined, and detection primer sequences are italicized.
[0057] The primer sequences of the specific 4 sites are as follows:
[0058] MTHFR (rs1801133)
[0059] F1: 5′-GAAGGTGACCAAGTTCATGCT AAAGCTGCGTGATGATGAAATCGA -3', as shown in SEQ ID NO: 1;
[0060] F2: 5′-GAAGGTCGGAGTCAACGGATT AAAGCTGCGTGATGATGAAATCGG -3', as shown in SEQ ID NO: 2;
[0061] R: 5'-TTGAGGCTGACCTGAAGCACTTGA-3', as shown in SEQ ID NO: 3;
[0062] MTHFR (rs180...
Embodiment 3
[0075] Embodiment 3 The establishment of PCR reaction system
[0076] The PCR amplification system includes commercially purchased 2x Mix (including Taq enzyme, 4 kinds of dNTPs, and two probes corresponding to the detection primer sequence of the forward primer). The PCR system is as follows:
[0077] PCR amplification system (10μL):
[0078]
[0079] Table 2: PCR reaction amplification program
[0080]
[0081] Fluorescence reading:
[0082] In an environment below 40°C, read the fluorescence value.
[0083] Interpretation of results:
[0084] For each SNP site, taking the MTHFR gene rs1801133 site as an example, there are three possible distribution types of this site in the population: CC, CT and TT. If a person’s genotype at this site is CC, only F1 primers can amplify normally, and F1 primers have a FAM luminescent group, showing blue fluorescence; if the genotype at this site is TT, only F2 primers can amplify normally Amplification, the F2 primer has a HEX ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap