Antigen used for early diagnosis of haemonchus contortus infection, and application thereof
A technology for early diagnosis of Haemonchus contortus, which is applied in the field of veterinary biotechnology and molecular biology, can solve the problem of no antigen, and achieve the effect of economical convenience, good application prospect and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Healthy goats were artificially infected with 8,000 third-stage larvae of Haemonchus contortus, and anticoagulant blood was taken from the goats on the 7th, 15th, 40th, and 60th days after infection, and goat peripheral blood mononuclear cells (PBMCs) were isolated, and immunocoagulation Precipitation technology and mass spectrometry analysis showed that more than 400 kinds of proteins excreted and secreted by Haemonchus contortus can be combined with PBMC of goats, and ADRM protein is one of them, and this protein appeared on the 7th day after the worm infected goats host blood, indicating that ADRM has potential early diagnostic value.
Embodiment 2
[0052] The total RNA of Haemonchus contortus adults was extracted, and cDNA templates were synthesized, using Hc-ADRM-F: CCgaattcATGTTTTTCTACATCCCGCTCTTCTC (EcoRI, SEQ ID NO.3) and Hc-ADRM-R: ATctcgag TTAGCAGCCGGATCTCAGTG (XhoⅠ, SEQ ID NO.4) as The Hc-ADRM fragment was amplified by PCR with primers, and the obtained HcADRM fragment and the prokaryotic expression plasmid pET-28a were digested, then connected, transformed and identified as positive clones, and sent to GenScript Biotechnology Co., Ltd. for sequencing. The nucleotide sequence of the HC-ADRM antigen is shown in SEQ ID NO.2.
Embodiment 3
[0053] Expression of embodiment 3 antigen rHC-ADRM
[0054] The Hc-ABHD positive clones with correct sequencing were inoculated in 1 L of liquid LB medium containing kanamycin (100 μg / mL) at a ratio of 1:100. When cultured at 37° C. with shaking at 180 rpm to the logarithmic phase (OD600 is about 0.6), IPTG (working concentration: 1 mM) was added. Continue to cultivate for 5h. After induction of expression, centrifuge at 8000 rpm for 10 min at low temperature, and discard the supernatant. After washing the cells with PBS for 2 times, resuspend with the supernatant Binding buffer, freeze and thaw repeatedly 2-3 times, and disrupt the cells by ultrasonic. The sonicated lysate was centrifuged at 4°C and 8000 rpm for 15 min, and the supernatant was collected. The precipitate was dissolved overnight at 4°C with 30-40mL inclusion body Binding buffer. The SDS-PAGE electrophoresis analysis of the supernatant and precipitated samples confirmed that the expression of the recombinant...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com